Incidental Mutation 'R4768:Top3a'
ID366288
Institutional Source Beutler Lab
Gene Symbol Top3a
Ensembl Gene ENSMUSG00000002814
Gene Nametopoisomerase (DNA) III alpha
SynonymsTop IIIa
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4768 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60740058-60777365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60762490 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 53 (F53L)
Ref Sequence ENSEMBL: ENSMUSP00000115727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably damaging
Transcript: ENSMUST00000002891
AA Change: F98L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814
AA Change: F98L

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102668
AA Change: F98L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814
AA Change: F98L

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117743
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814
AA Change: F73L

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120417
AA Change: F73L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814
AA Change: F73L

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130068
AA Change: F53L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814
AA Change: F53L

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Meta Mutation Damage Score 0.394 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele die shortly after implantation and the induction of decidual reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Olfr922 T A 9: 38,815,949 Y149N probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Top3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Top3a APN 11 60761736 missense probably damaging 1.00
IGL02935:Top3a APN 11 60762528 missense possibly damaging 0.53
R0057:Top3a UTSW 11 60740684 missense probably benign
R0057:Top3a UTSW 11 60740684 missense probably benign
R0369:Top3a UTSW 11 60742789 missense probably damaging 1.00
R1171:Top3a UTSW 11 60750593 missense probably benign 0.02
R1459:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1621:Top3a UTSW 11 60750607 missense probably damaging 1.00
R1812:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1839:Top3a UTSW 11 60753888 missense probably damaging 1.00
R1873:Top3a UTSW 11 60747984 nonsense probably null
R2004:Top3a UTSW 11 60742489 missense probably damaging 0.99
R2277:Top3a UTSW 11 60745874 missense possibly damaging 0.95
R2406:Top3a UTSW 11 60756012 missense probably damaging 1.00
R2418:Top3a UTSW 11 60748016 missense possibly damaging 0.95
R3196:Top3a UTSW 11 60759356 missense probably damaging 1.00
R3879:Top3a UTSW 11 60743939 missense possibly damaging 0.92
R4695:Top3a UTSW 11 60742412 missense probably benign 0.40
R4715:Top3a UTSW 11 60742997 nonsense probably null
R4910:Top3a UTSW 11 60752378 splice site probably benign
R5305:Top3a UTSW 11 60762539 missense possibly damaging 0.56
R5387:Top3a UTSW 11 60762490 missense probably damaging 1.00
R5419:Top3a UTSW 11 60762522 missense probably damaging 1.00
R5806:Top3a UTSW 11 60776920 critical splice donor site probably null
R6162:Top3a UTSW 11 60745937 missense probably damaging 1.00
R6279:Top3a UTSW 11 60749408 missense probably benign 0.02
R6300:Top3a UTSW 11 60749408 missense probably benign 0.02
R6381:Top3a UTSW 11 60744023 missense probably damaging 1.00
R6383:Top3a UTSW 11 60749459 missense probably benign 0.30
R6767:Top3a UTSW 11 60750753 missense possibly damaging 0.84
R6919:Top3a UTSW 11 60749493 missense probably damaging 1.00
R7299:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7301:Top3a UTSW 11 60748148 missense probably damaging 0.99
X0063:Top3a UTSW 11 60750644 nonsense probably null
X0065:Top3a UTSW 11 60763398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTTGCACTGAAAAGAGTG -3'
(R):5'- AATGGTGGCTGTATCAACATGG -3'

Sequencing Primer
(F):5'- CACTGAAAAGAGTGAGTGTTGATTC -3'
(R):5'- GGTTTTGCCAAGTTACAATTAGTTCC -3'
Posted On2015-12-21