Incidental Mutation 'R0411:Tns1'
ID36630
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R0411 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73925761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1237 (V1237E)
Ref Sequence ENSEMBL: ENSMUSP00000148638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169786
AA Change: V1245E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: V1245E

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185264
Predicted Effect unknown
Transcript: ENSMUST00000185331
AA Change: V1062E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185529
Predicted Effect unknown
Transcript: ENSMUST00000185702
AA Change: V1075E
Predicted Effect possibly damaging
Transcript: ENSMUST00000187584
AA Change: V1180E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: V1180E

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187691
SMART Domains Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
SH2 350 452 4.3e-19 SMART
PTB 483 624 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189228
Predicted Effect possibly damaging
Transcript: ENSMUST00000191104
AA Change: V1224E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: V1224E

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191527
Predicted Effect probably damaging
Transcript: ENSMUST00000212888
AA Change: V1237E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACCTGCCGATGGCTCAAACTG -3'
(R):5'- AGAAAGCCCCGACTTCCTCTTGAC -3'

Sequencing Primer
(F):5'- GATGGCTCAAACTGGGACTACC -3'
(R):5'- CCTCTTGACTGAGTGGAGC -3'
Posted On2013-05-09