Incidental Mutation 'R4769:Aox4'
ID366305
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Namealdehyde oxidase 4
Synonyms2310003G12Rik, AOH2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58210397-58268597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58259148 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1091 (D1091G)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
Predicted Effect probably null
Transcript: ENSMUST00000040442
AA Change: D1091G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: D1091G

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161833
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R0825:Aox4 UTSW 1 58248909 missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3745:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6179:Aox4 UTSW 1 58231503 missense probably benign
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R6885:Aox4 UTSW 1 58264378 missense probably damaging 1.00
R7082:Aox4 UTSW 1 58224193 missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58228874 missense probably benign 0.00
R7153:Aox4 UTSW 1 58250219 missense probably damaging 0.99
R7371:Aox4 UTSW 1 58263854 missense probably damaging 1.00
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGCTTCATGCTCAGTTC -3'
(R):5'- ACATGGGTTAAGGTCAGCAGC -3'

Sequencing Primer
(F):5'- CAGGCTTCATGCTCAGTTCTAGAAG -3'
(R):5'- TTAAGGTCAGCAGCCCATG -3'
Posted On2015-12-21