Incidental Mutation 'R4769:Clp1'
ID366314
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene NameCLP1, cleavage and polyadenylation factor I subunit
Synonyms
Accession Numbers

Genbank: NM_133840; MGI: 2138968

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84722104-84727350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84725875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000129300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028475
AA Change: D87G

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: D87G

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138231
Predicted Effect possibly damaging
Transcript: ENSMUST00000165219
AA Change: D87G

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: D87G

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84723864 missense probably benign 0.36
D4186:Clp1 UTSW 2 84725635 missense probably benign 0.00
R0540:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84724051 missense probably damaging 1.00
R2908:Clp1 UTSW 2 84724144 missense possibly damaging 0.89
R4949:Clp1 UTSW 2 84723742 missense possibly damaging 0.58
R5568:Clp1 UTSW 2 84725978 nonsense probably null
R7191:Clp1 UTSW 2 84724146 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTACATCTAACTCCACG -3'
(R):5'- AACAGAGCTTCGATTTGAGGTGG -3'

Sequencing Primer
(F):5'- GTAAGTAGGACGGCGGCC -3'
(R):5'- GAGGCCTCTCAATCGGTTCAG -3'
Posted On2015-12-21