Incidental Mutation 'R4769:Olfr1163'
ID366315
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88070729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 218 (T218P)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably benign
Transcript: ENSMUST00000099835
AA Change: T218P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: T218P

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215268
AA Change: T218P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1274:Olfr1163 UTSW 2 88070595 missense probably damaging 1.00
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R3056:Olfr1163 UTSW 2 88071239 missense probably benign
R4127:Olfr1163 UTSW 2 88071235 missense probably benign 0.00
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7111:Olfr1163 UTSW 2 88070656 missense probably damaging 1.00
R7168:Olfr1163 UTSW 2 88070577 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GAGGCTACTTTGACGGCATTCC -3'
(R):5'- ATCCTGCTTGTGACTGGGTC -3'

Sequencing Primer
(F):5'- CCTAGAATTTTTGGAGTTCGGTACAC -3'
(R):5'- ACTGGGTCATATATCTGGAGTACC -3'
Posted On2015-12-21