Incidental Mutation 'R4769:Ncapd2'
ID366330
Institutional Source Beutler Lab
Gene Symbol Ncapd2
Ensembl Gene ENSMUSG00000038252
Gene Namenon-SMC condensin I complex, subunit D2
Synonyms2810406C15Rik, 2810465G24Rik, CNAP1, CAP-D2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125168007-125191701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 125185745 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 179 (L179R)
Ref Sequence ENSEMBL: ENSMUSP00000042260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848] [ENSMUST00000188762] [ENSMUST00000189959]
Predicted Effect probably damaging
Transcript: ENSMUST00000043848
AA Change: L179R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252
AA Change: L179R

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187351
Predicted Effect probably benign
Transcript: ENSMUST00000188762
Predicted Effect probably benign
Transcript: ENSMUST00000189959
SMART Domains Protein: ENSMUSP00000139445
Gene: ENSMUSG00000038252

DomainStartEndE-ValueType
Pfam:Cnd1_N 73 162 8.3e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Etfa A T 9: 55,495,767 H81Q possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Ncapd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Ncapd2 APN 6 125173425 missense probably benign 0.05
IGL00960:Ncapd2 APN 6 125173848 missense probably benign
IGL01307:Ncapd2 APN 6 125168619 missense possibly damaging 0.56
IGL01612:Ncapd2 APN 6 125177872 missense probably benign 0.01
IGL01903:Ncapd2 APN 6 125177460 missense probably benign
IGL01987:Ncapd2 APN 6 125185841 splice site probably benign
IGL01998:Ncapd2 APN 6 125173115 missense probably benign 0.18
IGL01998:Ncapd2 APN 6 125169933 missense probably damaging 1.00
IGL02329:Ncapd2 APN 6 125189818 missense probably damaging 0.99
IGL02550:Ncapd2 APN 6 125177447 missense probably benign
IGL02662:Ncapd2 APN 6 125176731 missense probably damaging 1.00
IGL02817:Ncapd2 APN 6 125170914 critical splice donor site probably null
IGL03121:Ncapd2 APN 6 125173612 missense probably benign 0.00
IGL03206:Ncapd2 APN 6 125171697 missense possibly damaging 0.85
FR4548:Ncapd2 UTSW 6 125173596 critical splice donor site probably benign
PIT4305001:Ncapd2 UTSW 6 125184027 nonsense probably null
R0486:Ncapd2 UTSW 6 125184027 nonsense probably null
R0635:Ncapd2 UTSW 6 125173036 missense probably benign 0.00
R0699:Ncapd2 UTSW 6 125169880 missense probably benign
R0746:Ncapd2 UTSW 6 125174264 missense possibly damaging 0.50
R0893:Ncapd2 UTSW 6 125173482 missense probably benign
R1385:Ncapd2 UTSW 6 125173115 missense probably benign 0.18
R1513:Ncapd2 UTSW 6 125170992 missense probably damaging 1.00
R1601:Ncapd2 UTSW 6 125185772 missense probably damaging 1.00
R1698:Ncapd2 UTSW 6 125168590 missense probably null 0.39
R2030:Ncapd2 UTSW 6 125176715 missense possibly damaging 0.95
R2035:Ncapd2 UTSW 6 125184528 missense probably benign 0.17
R2359:Ncapd2 UTSW 6 125179416 unclassified probably benign
R3951:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3952:Ncapd2 UTSW 6 125186784 missense probably damaging 0.98
R3953:Ncapd2 UTSW 6 125170734 missense probably damaging 0.96
R4623:Ncapd2 UTSW 6 125173609 missense probably benign 0.04
R4630:Ncapd2 UTSW 6 125179233 splice site probably null
R4667:Ncapd2 UTSW 6 125184518 missense possibly damaging 0.69
R4936:Ncapd2 UTSW 6 125169840 missense probably benign 0.18
R5130:Ncapd2 UTSW 6 125169924 missense possibly damaging 0.90
R5465:Ncapd2 UTSW 6 125176783 missense probably damaging 0.98
R5806:Ncapd2 UTSW 6 125181154 missense probably damaging 0.98
R5823:Ncapd2 UTSW 6 125168700 missense probably benign 0.00
R5888:Ncapd2 UTSW 6 125187089 missense probably damaging 1.00
R5940:Ncapd2 UTSW 6 125168869 missense probably benign
R6198:Ncapd2 UTSW 6 125179323 nonsense probably null
R6406:Ncapd2 UTSW 6 125173878 missense probably benign
R6652:Ncapd2 UTSW 6 125186270 missense probably benign 0.13
R6959:Ncapd2 UTSW 6 125168920 missense probably benign
R6977:Ncapd2 UTSW 6 125171509 missense probably damaging 1.00
R6982:Ncapd2 UTSW 6 125176736 missense probably damaging 0.96
R7143:Ncapd2 UTSW 6 125179561 missense probably benign
R7144:Ncapd2 UTSW 6 125176670 missense probably benign 0.11
R7186:Ncapd2 UTSW 6 125186156 missense possibly damaging 0.89
R7203:Ncapd2 UTSW 6 125184328 missense possibly damaging 0.58
R7384:Ncapd2 UTSW 6 125173401 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGCACATTCCATTCAGTATG -3'
(R):5'- TATCCTCCATGGTACTGCCTGG -3'

Sequencing Primer
(F):5'- TGCATGTAATAGACACTCCTATGTAC -3'
(R):5'- GCCTTGCCTTGATACTGAGTGC -3'
Posted On2015-12-21