Incidental Mutation 'R4769:Etfa'
ID366346
Institutional Source Beutler Lab
Gene Symbol Etfa
Ensembl Gene ENSMUSG00000032314
Gene Nameelectron transferring flavoprotein, alpha polypeptide
Synonyms2010200I21Rik, D9Ertd394e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R4769 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55454508-55512243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55495767 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 81 (H81Q)
Ref Sequence ENSEMBL: ENSMUSP00000034866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034866
AA Change: H81Q

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034866
Gene: ENSMUSG00000032314
AA Change: H81Q

DomainStartEndE-ValueType
ETF 22 203 4.71e-48 SMART
Pfam:ETF_alpha 210 293 6.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153186
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ETFA participates in catalyzing the initial step of the mitochondrial fatty acid beta-oxidation. It shuttles electrons between primary flavoprotein dehydrogenases and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. Defects in electron-transfer-flavoprotein have been implicated in type II glutaricaciduria in which multiple acyl-CoA dehydrogenase deficiencies result in large excretion of glutaric, lactic, ethylmalonic, butyric, isobutyric, 2-methyl-butyric, and isovaleric acids. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A C 14: 32,660,217 S1264A probably benign Het
Adamts13 T G 2: 27,008,711 Y1361* probably null Het
Ahrr A T 13: 74,214,212 D389E probably damaging Het
Alx3 T C 3: 107,600,691 F172S probably damaging Het
Antxrl A G 14: 34,073,070 H485R possibly damaging Het
Aox4 A G 1: 58,259,148 D1091G probably null Het
Btbd1 T A 7: 81,805,810 Q271L probably benign Het
Cd209c A T 8: 3,944,953 N70K probably benign Het
Cdc14a C T 3: 116,294,750 probably null Het
Cenpe A G 3: 135,248,151 M1641V probably benign Het
Clec2e G A 6: 129,100,827 T16I probably benign Het
Clp1 T C 2: 84,725,875 D87G possibly damaging Het
Dpy19l1 A T 9: 24,426,148 F517I probably damaging Het
Dzip3 T C 16: 48,938,474 N646S probably damaging Het
Ephx1 T A 1: 180,995,978 Y188F possibly damaging Het
Gigyf2 T A 1: 87,440,849 F1084I probably damaging Het
Heatr3 T C 8: 88,141,783 probably null Het
Ift81 G T 5: 122,594,593 H293N probably benign Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Il6 T G 5: 30,018,078 L114* probably null Het
Ism2 A T 12: 87,299,581 M42K probably benign Het
Lhx5 A G 5: 120,436,438 E269G probably benign Het
Marveld1 T G 19: 42,147,995 M116R possibly damaging Het
Micall2 A G 5: 139,706,886 S911P probably damaging Het
Mier1 G A 4: 103,140,220 R195H probably benign Het
Muc2 T A 7: 141,699,691 probably null Het
Mybbp1a A G 11: 72,445,640 K486R probably damaging Het
Ncapd2 A C 6: 125,185,745 L179R probably damaging Het
Nos1 C T 5: 117,943,245 Q1171* probably null Het
Nrg1 T A 8: 31,917,972 I78F probably damaging Het
Olfr1163 T G 2: 88,070,729 T218P probably benign Het
Olfr220 T G 1: 174,448,958 F112V possibly damaging Het
Plek2 C T 12: 78,906,890 probably null Het
Plod2 A G 9: 92,595,272 H339R probably damaging Het
Pold1 C T 7: 44,535,071 C835Y probably damaging Het
Polr1a A G 6: 71,950,868 I868V probably benign Het
Prss54 C A 8: 95,559,375 V357L probably benign Het
Rbbp8 T A 18: 11,722,670 S625T probably damaging Het
Rgs1 A T 1: 144,247,929 L86Q probably damaging Het
Ripk4 T A 16: 97,744,062 N462Y probably damaging Het
Rsf1 C T 7: 97,676,222 L1011F probably damaging Het
Slc19a3 G A 1: 83,019,341 T382I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Trim45 C A 3: 100,931,734 probably benign Het
Umodl1 G T 17: 30,984,002 R443M possibly damaging Het
Vmn1r11 G A 6: 57,137,612 R87K probably damaging Het
Vmn1r78 T A 7: 12,152,798 I112N probably damaging Het
Zeb2 T G 2: 44,996,435 E825A probably damaging Het
Zfp930 A T 8: 69,226,692 I50F probably benign Het
Other mutations in Etfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02214:Etfa APN 9 55464811 missense probably damaging 1.00
IGL02471:Etfa APN 9 55486700 critical splice donor site probably null
IGL03068:Etfa APN 9 55487482 missense probably benign
R0944:Etfa UTSW 9 55488838 missense probably damaging 1.00
R2267:Etfa UTSW 9 55486731 missense probably damaging 1.00
R2913:Etfa UTSW 9 55482329 missense probably damaging 1.00
R4528:Etfa UTSW 9 55500050 missense probably damaging 1.00
R5055:Etfa UTSW 9 55500133 missense probably damaging 1.00
R5089:Etfa UTSW 9 55488866 nonsense probably null
R5402:Etfa UTSW 9 55454739 missense probably benign
R6141:Etfa UTSW 9 55464819 missense probably damaging 1.00
R6363:Etfa UTSW 9 55500133 missense probably damaging 1.00
R6574:Etfa UTSW 9 55495626 missense probably damaging 1.00
R6835:Etfa UTSW 9 55495819 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTCACCTTTCCAAAAGCAG -3'
(R):5'- ATGGGTAGCATTCCCCTACACC -3'

Sequencing Primer
(F):5'- ACAGATGTGTGTGTAACTGAACTGC -3'
(R):5'- GGTAGCATTCCCCTACACCATCTC -3'
Posted On2015-12-21