Incidental Mutation 'R4780:Anks1b'
ID366431
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 041993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R4780 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89873732 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 21 (K21E)
Ref Sequence ENSEMBL: ENSMUSP00000096968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect probably damaging
Transcript: ENSMUST00000099368
AA Change: K21E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182907
AA Change: K21E
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182936
AA Change: K21E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183156
AA Change: K21E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,370 N107D probably benign Het
4833413E03Rik A C 17: 31,558,764 noncoding transcript Het
4931429L15Rik G T 9: 46,308,846 H129Q possibly damaging Het
A730018C14Rik A G 12: 112,415,635 noncoding transcript Het
Abcc6 T A 7: 45,996,691 K791N probably benign Het
Adcy4 T G 14: 55,775,036 Q550P probably benign Het
Add3 C A 19: 53,234,792 A325E possibly damaging Het
Agbl4 T A 4: 111,657,331 I513N possibly damaging Het
Agfg1 C A 1: 82,886,387 T392K probably damaging Het
Akna C A 4: 63,379,254 M854I probably benign Het
Ankrd44 T C 1: 54,763,757 N194S probably benign Het
Ap1s3 A G 1: 79,609,172 F154L probably benign Het
Apbb2 T A 5: 66,362,817 N477I probably damaging Het
Apobec3 T C 15: 79,899,024 C101R possibly damaging Het
Arnt G T 3: 95,488,385 V410F probably damaging Het
Arsg G A 11: 109,534,013 R270H possibly damaging Het
B3gnt7 T A 1: 86,305,270 D79E probably damaging Het
BC067074 A G 13: 113,317,858 Y146C probably damaging Het
Cd44 G T 2: 102,861,565 A126D probably damaging Het
Cd69 A G 6: 129,271,355 I56T probably damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces2a T C 8: 104,737,208 F184S probably damaging Het
Chrng A G 1: 87,207,524 N185S probably damaging Het
Cldn6 A T 17: 23,681,247 M62L probably benign Het
Cntn6 T A 6: 104,845,784 N765K probably damaging Het
Ctnnal1 T C 4: 56,847,857 D94G probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Depdc1a A G 3: 159,526,706 N698S probably benign Het
Dnah2 A T 11: 69,473,871 I1986N probably damaging Het
Dnah7b A G 1: 46,353,014 E3845G probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Dync1h1 T C 12: 110,661,196 Y4047H probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
E2f5 A G 3: 14,587,319 T72A probably benign Het
Ephb6 G T 6: 41,616,139 R437L probably damaging Het
Erbb4 T C 1: 68,298,314 H615R probably damaging Het
Erbin T C 13: 103,884,206 T82A probably damaging Het
Eri2 T C 7: 119,785,680 N533D probably benign Het
Fkbp9 A G 6: 56,850,716 N174S probably damaging Het
Fsbp C T 4: 11,583,709 T136I possibly damaging Het
Fubp3 C A 2: 31,583,211 D47E probably damaging Het
Gm21850 G A 2: 154,056,499 noncoding transcript Het
Gm5141 T A 13: 62,774,950 Y135F unknown Het
Gm7353 T A 7: 3,110,725 noncoding transcript Het
Gm8765 C A 13: 50,701,080 S251R probably damaging Het
Gm9925 T C 18: 74,065,273 probably benign Het
Greb1l T C 18: 10,541,792 S1180P probably benign Het
Hist1h2ag G A 13: 22,042,909 Q7* probably null Het
Kiz A G 2: 146,889,246 T192A possibly damaging Het
Klhl24 T A 16: 20,106,958 C79S probably damaging Het
Map3k11 A G 19: 5,690,938 H231R probably damaging Het
Mbd4 C A 6: 115,849,384 R194S probably benign Het
Mettl21e A C 1: 44,211,143 S34R probably benign Het
Mrps5 T C 2: 127,598,241 V245A probably benign Het
Mtrf1 T C 14: 79,401,688 Y87H probably benign Het
Myh15 T C 16: 49,120,057 I790T probably benign Het
Necab1 T G 4: 14,989,248 I176L probably benign Het
Nfkb2 T A 19: 46,309,922 L555Q probably damaging Het
Nhlrc3 T A 3: 53,458,567 E168D probably benign Het
Nlrp5 T A 7: 23,435,778 C949S probably damaging Het
Nup155 C A 15: 8,157,703 A1372E probably benign Het
Nynrin G T 14: 55,863,263 R170L probably damaging Het
Ogfrl1 T A 1: 23,370,321 N275Y probably damaging Het
Olfr1110 C T 2: 87,135,877 S148N probably damaging Het
Olfr1302 A G 2: 111,780,845 D175G probably damaging Het
Olfr1480 A G 19: 13,529,955 N138S probably benign Het
Olfr912 A G 9: 38,581,969 T231A possibly damaging Het
Olr1 A T 6: 129,488,876 S56T probably damaging Het
Ovol2 A T 2: 144,331,283 probably benign Het
Pcdha6 A T 18: 36,969,853 I700F probably damaging Het
Prkcz C T 4: 155,289,702 V86M probably damaging Het
Ptpn13 A G 5: 103,586,773 T2124A probably benign Het
Ranbp3 G T 17: 56,673,346 probably benign Het
Rapgef2 A G 3: 79,169,769 probably benign Het
Rbl1 A G 2: 157,174,804 V625A probably benign Het
Rbm38 G T 2: 173,022,151 G38C probably damaging Het
Reg1 T G 6: 78,426,350 F7C possibly damaging Het
Retnlg A T 16: 48,874,334 Q115L possibly damaging Het
Rhobtb1 G A 10: 69,270,153 V183I probably benign Het
Rims1 T C 1: 22,291,105 Q1186R probably damaging Het
Ryr1 A G 7: 29,095,097 F1246L possibly damaging Het
Samm50 A G 15: 84,210,610 N401S possibly damaging Het
Scn3a T A 2: 65,506,193 I690F probably damaging Het
Sdk1 A G 5: 141,959,238 D304G probably damaging Het
Skint6 T C 4: 113,236,397 Y183C probably damaging Het
Slamf1 A T 1: 171,777,261 T200S probably benign Het
Slc34a2 C T 5: 53,069,451 R639C probably damaging Het
Smap1 A T 1: 23,853,436 M149K probably benign Het
Sorcs1 T C 19: 50,143,981 probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Strip1 G A 3: 107,626,998 T136I probably benign Het
Tacr1 A T 6: 82,557,072 T360S probably benign Het
Tbc1d14 T A 5: 36,571,256 probably benign Het
Tcaf2 T C 6: 42,628,062 Y596C probably damaging Het
Tspoap1 C T 11: 87,778,443 T1454I possibly damaging Het
Ttc30a2 A C 2: 75,977,576 C197W probably benign Het
Ttn A T 2: 76,914,583 M5374K probably benign Het
Uts2r G A 11: 121,160,879 V190I possibly damaging Het
Vmn1r181 A G 7: 23,984,583 T158A possibly damaging Het
Wdr35 A T 12: 9,018,150 T778S probably benign Het
Xrn1 A T 9: 95,974,744 probably benign Het
Zfp35 A T 18: 24,003,269 K223N probably damaging Het
Zfp764 T C 7: 127,404,771 Q396R probably benign Het
Zfyve1 T C 12: 83,558,647 Y11C probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCCCATTGTAGAAGCTG -3'
(R):5'- ACCCTGAGGAGAGAACGTAC -3'

Sequencing Primer
(F):5'- CATTGTAGAAGCTGCGCGG -3'
(R):5'- CTGAGGAGAGAACGTACCCATC -3'
Posted On2015-12-21