Incidental Mutation 'R0411:Olfr1329'
ID36647
Institutional Source Beutler Lab
Gene Symbol Olfr1329
Ensembl Gene ENSMUSG00000096705
Gene Nameolfactory receptor 1329
SynonymsMOR259-2, GA_x6K02T2QD9B-18619941-18620882
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118916524-118917465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118916626 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 280 (N280K)
Ref Sequence ENSEMBL: ENSMUSP00000071870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071979
AA Change: N280K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071870
Gene: ENSMUSG00000096705
AA Change: N280K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.5e-6 PFAM
Pfam:7tm_1 42 291 5.7e-25 PFAM
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Olfr1329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1329 APN 4 118916894 missense possibly damaging 0.67
IGL02065:Olfr1329 APN 4 118916771 missense probably benign 0.00
IGL02085:Olfr1329 APN 4 118916750 missense probably damaging 1.00
IGL02092:Olfr1329 APN 4 118916990 missense possibly damaging 0.72
IGL02557:Olfr1329 APN 4 118917192 missense probably benign 0.00
R0129:Olfr1329 UTSW 4 118917470 unclassified probably null
R5001:Olfr1329 UTSW 4 118917243 missense probably damaging 0.97
R5313:Olfr1329 UTSW 4 118916798 missense probably benign 0.00
R5733:Olfr1329 UTSW 4 118916838 missense probably benign 0.00
R6153:Olfr1329 UTSW 4 118916747 missense probably damaging 1.00
R6274:Olfr1329 UTSW 4 118917230 missense probably benign 0.01
Z1088:Olfr1329 UTSW 4 118916588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCTCAGTCTCATGAACATCCC -3'
(R):5'- GTAGCCTGGCTTGCATGGATACTC -3'

Sequencing Primer
(F):5'- CCCAGGTCAAGACGAATGTTG -3'
(R):5'- GCTTGCATGGATACTCATGTC -3'
Posted On2013-05-09