Incidental Mutation 'R0411:Ddost'
ID36648
Institutional Source Beutler Lab
Gene Symbol Ddost
Ensembl Gene ENSMUSG00000028757
Gene Namedolichyl-di-phosphooligosaccharide-protein glycotransferase
Synonyms
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138304730-138312628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138309653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 176 (S176T)
Ref Sequence ENSEMBL: ENSMUSP00000030538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030536] [ENSMUST00000030538] [ENSMUST00000105816] [ENSMUST00000105817]
Predicted Effect probably benign
Transcript: ENSMUST00000030536
SMART Domains Protein: ENSMUSP00000030536
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 30 43 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 105 110 N/A INTRINSIC
Pfam:Pkinase 257 508 2.9e-24 PFAM
Pfam:Pkinase_Tyr 306 506 4e-15 PFAM
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030538
AA Change: S176T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030538
Gene: ENSMUSG00000028757
AA Change: S176T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:DDOST_48kD 32 441 4.5e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105816
SMART Domains Protein: ENSMUSP00000101442
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 94 4.6e-6 PFAM
Pfam:Pkinase 1 96 8.4e-9 PFAM
low complexity region 146 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105817
SMART Domains Protein: ENSMUSP00000101443
Gene: ENSMUSG00000028756

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 75 80 N/A INTRINSIC
Pfam:Pkinase 231 478 7.9e-29 PFAM
Pfam:Pkinase_Tyr 276 476 1.2e-15 PFAM
low complexity region 528 543 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the oligosaccharyltransferase complex which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues on nascent polypeptides in the lumen of the rough endoplasmic reticulum. The protein complex co-purifies with ribosomes. The product of this gene is also implicated in the processing of advanced glycation endproducts (AGEs), which form from non-enzymatic reactions between sugars and proteins or lipids and are associated with aging and hyperglycemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Ddost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Ddost APN 4 138311703 missense probably damaging 1.00
IGL01636:Ddost APN 4 138309396 missense possibly damaging 0.94
R0211:Ddost UTSW 4 138309602 missense probably damaging 1.00
R0211:Ddost UTSW 4 138309602 missense probably damaging 1.00
R0310:Ddost UTSW 4 138310611 missense probably benign 0.25
R0452:Ddost UTSW 4 138310188 missense possibly damaging 0.80
R0521:Ddost UTSW 4 138310735 missense probably benign
R5336:Ddost UTSW 4 138309430 missense possibly damaging 0.81
X0011:Ddost UTSW 4 138309397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCATCGACCACCACAACTATG -3'
(R):5'- CCAAGCACTTGGGCTCCTCATTTAC -3'

Sequencing Primer
(F):5'- GACCACCACAACTATGATGTTTCTG -3'
(R):5'- GGGCTCCTCATTTACAGTGAGAC -3'
Posted On2013-05-09