Incidental Mutation 'R4781:Hectd4'
ID366487
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R4781 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 121306107 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614] [ENSMUST00000042614] [ENSMUST00000100769] [ENSMUST00000100769]
Predicted Effect probably null
Transcript: ENSMUST00000042614
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000042614
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100769
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100769
SMART Domains Protein: ENSMUSP00000098332
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
low complexity region 214 225 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119892
SMART Domains Protein: ENSMUSP00000112647
Gene: ENSMUSG00000042744

DomainStartEndE-ValueType
low complexity region 261 272 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 960 973 N/A INTRINSIC
coiled coil region 1080 1106 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1433 1449 N/A INTRINSIC
low complexity region 1600 1612 N/A INTRINSIC
low complexity region 2364 2374 N/A INTRINSIC
low complexity region 2565 2580 N/A INTRINSIC
low complexity region 2609 2625 N/A INTRINSIC
low complexity region 2629 2641 N/A INTRINSIC
low complexity region 2940 2954 N/A INTRINSIC
low complexity region 2983 3043 N/A INTRINSIC
low complexity region 3149 3156 N/A INTRINSIC
low complexity region 3181 3214 N/A INTRINSIC
low complexity region 3220 3241 N/A INTRINSIC
low complexity region 3248 3262 N/A INTRINSIC
low complexity region 3502 3530 N/A INTRINSIC
HECTc 3756 4120 4.78e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128514
Predicted Effect probably benign
Transcript: ENSMUST00000201669
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Trpm1 A G 7: 64,235,052 D827G probably benign Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAATCTGCTGTCGGGAACTG -3'
(R):5'- CCTAACGCATCAATCTAGCTGC -3'

Sequencing Primer
(F):5'- AGTAAGCAGTCACTGGCTGTCAC -3'
(R):5'- ATGGGTGTGTCACACAGT -3'
Posted On2015-12-21