Incidental Mutation 'R4781:Trpm1'
ID366497
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 042415-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4781 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64235052 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 827 (D827G)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: D827G

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: D827G

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138074
AA Change: D251G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: D711G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: D827G

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,571,651 I157N probably damaging Het
Adgrl3 T C 5: 81,760,724 Y1165H probably damaging Het
Adra2a A G 19: 54,046,495 D94G probably damaging Het
Akr1c20 T A 13: 4,508,175 K197* probably null Het
Ankrd65 C T 4: 155,793,036 H335Y possibly damaging Het
Axin2 T A 11: 108,943,856 L636Q probably damaging Het
BC147527 A C 13: 120,308,162 K6T possibly damaging Het
Camk1g G T 1: 193,356,344 T90N probably benign Het
Cd177 C A 7: 24,750,626 C528F probably damaging Het
Cntnap5a A T 1: 116,412,201 D730V possibly damaging Het
Crtap T C 9: 114,386,236 D195G probably benign Het
Csn1s2b A G 5: 87,819,093 S74G possibly damaging Het
Cyp3a16 T C 5: 145,456,112 R128G possibly damaging Het
Dnah7a A G 1: 53,425,208 F3675L probably benign Het
Dram2 T A 3: 106,571,676 W195R probably damaging Het
E130308A19Rik C T 4: 59,691,057 P297L probably benign Het
Eif3i T C 4: 129,595,273 S83G probably benign Het
Gabra1 G A 11: 42,133,661 P396S probably damaging Het
Gipr T A 7: 19,157,375 Y459F possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm6981 T C 9: 52,002,756 noncoding transcript Het
Grin2d T C 7: 45,862,481 D180G probably damaging Het
Hectd4 T G 5: 121,306,107 probably null Het
Hhat T C 1: 192,686,979 probably benign Het
Hoxa6 A G 6: 52,206,420 L215P possibly damaging Het
Hsf4 G A 8: 105,274,752 probably null Het
Igf1r G A 7: 68,165,199 A283T possibly damaging Het
Ighv15-2 A G 12: 114,564,856 S25P probably damaging Het
Inpp5a C T 7: 139,478,005 T43I probably benign Het
Kmt2c T A 5: 25,443,825 E82V probably damaging Het
Lrrc31 A G 3: 30,687,377 probably benign Het
Mdga2 A G 12: 66,797,622 probably null Het
Mefv G A 16: 3,715,334 P358S probably benign Het
Mrgpra9 A G 7: 47,235,047 F291L possibly damaging Het
Mtmr3 A G 11: 4,488,435 L673P probably benign Het
Muc19 T C 15: 91,903,166 noncoding transcript Het
Myo5b A T 18: 74,744,681 T1584S possibly damaging Het
Olfr1375 A T 11: 51,048,480 R124S probably damaging Het
Olfr1427 T C 19: 12,099,367 T91A probably benign Het
Palld G T 8: 61,877,028 R272S probably benign Het
Pcnx3 T A 19: 5,687,130 N144Y probably damaging Het
Prf1 A G 10: 61,300,424 K160E probably damaging Het
Rasgrp1 G A 2: 117,291,709 A400V probably benign Het
Rnf150 A G 8: 82,864,152 Y48C probably damaging Het
Rpl11 G T 4: 136,050,288 Q170K probably benign Het
Scin G A 12: 40,081,764 A257V possibly damaging Het
Scn7a C A 2: 66,703,760 A524S possibly damaging Het
Sim1 T C 10: 50,983,785 L581S probably benign Het
Skor1 T C 9: 63,144,459 T715A probably benign Het
Slc22a26 A G 19: 7,790,135 V301A probably benign Het
Sorcs1 T C 19: 50,182,681 Y923C probably damaging Het
Src T A 2: 157,467,485 M304K possibly damaging Het
Srgap3 A T 6: 112,757,425 probably benign Het
Stard3 G A 11: 98,372,334 E72K possibly damaging Het
Svep1 T A 4: 58,070,340 N2482I probably damaging Het
Tbc1d23 T C 16: 57,218,415 K20R possibly damaging Het
Tfip11 G A 5: 112,333,399 E414K probably damaging Het
Tinag G T 9: 76,996,950 T397K possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Trmt10b T A 4: 45,305,817 I164N probably damaging Het
Ube2u A T 4: 100,486,658 T85S probably benign Het
Ulk4 T C 9: 121,103,576 D1066G probably benign Het
Vmn2r72 T A 7: 85,737,861 I832F probably benign Het
Yipf1 A C 4: 107,336,158 E80D probably benign Het
Zfp40 T A 17: 23,175,655 R653W probably damaging Het
Zxdc A G 6: 90,372,553 T308A probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGTGAGCTGCTTTGCCCTC -3'
(R):5'- AGGTGGGATTAGGCCATTCC -3'

Sequencing Primer
(F):5'- GGTATGTTGTCACAGCACAC -3'
(R):5'- GGATTAGGCCATTCCCAACACATG -3'
Posted On2015-12-21