Incidental Mutation 'R0411:Slc6a5'
ID36658
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49911791 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 24 (R24W)
Ref Sequence ENSEMBL: ENSMUSP00000146430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably damaging
Transcript: ENSMUST00000056442
AA Change: R24W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: R24W

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107605
AA Change: R24W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: R24W

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207753
AA Change: R24W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000209172
AA Change: R24W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCTTCTTCATGTCCCAGGATTACAGAC -3'
(R):5'- CTGCTGAGATTACAAAACCCTACTCCG -3'

Sequencing Primer
(F):5'- GTGCCTGGACCTGGAATG -3'
(R):5'- CATCCGCAGACTGGAAAGT -3'
Posted On2013-05-09