Incidental Mutation 'R4782:Mfsd10'
ID366584
Institutional Source Beutler Lab
Gene Symbol Mfsd10
Ensembl Gene ENSMUSG00000001082
Gene Namemajor facilitator superfamily domain containing 10
SynonymsTetran, 0610009O03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R4782 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34633642-34637212 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 34634949 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000001109] [ENSMUST00000041364] [ENSMUST00000052836] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000124668] [ENSMUST00000126257] [ENSMUST00000134156] [ENSMUST00000137150] [ENSMUST00000137506] [ENSMUST00000149657] [ENSMUST00000155577] [ENSMUST00000201147] [ENSMUST00000201810] [ENSMUST00000202378]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000001109
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041364
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114329
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000114331
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124668
SMART Domains Protein: ENSMUSP00000119140
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130347
Predicted Effect probably benign
Transcript: ENSMUST00000134156
SMART Domains Protein: ENSMUSP00000143812
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136010
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137262
Predicted Effect probably benign
Transcript: ENSMUST00000137506
SMART Domains Protein: ENSMUSP00000144121
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 31 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148270
Predicted Effect probably benign
Transcript: ENSMUST00000149657
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151247
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000155577
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200717
Predicted Effect unknown
Transcript: ENSMUST00000201147
AA Change: Y98C
SMART Domains Protein: ENSMUSP00000144239
Gene: ENSMUSG00000001082
AA Change: Y98C

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202065
Predicted Effect silent
Transcript: ENSMUST00000202378
SMART Domains Protein: ENSMUSP00000144117
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein likely functions in efflux of organic anions, including the non-steroidal anti-inflammatory drugs indomethacin and diclofenac. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,328,096 E3092G probably damaging Het
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Abtb2 A T 2: 103,717,299 D1006V probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ahnak A G 19: 9,012,499 probably benign Het
Akap6 CA C 12: 52,887,623 probably null Het
Amotl2 T G 9: 102,720,123 probably null Het
Ankrd34b T A 13: 92,438,305 I15N probably damaging Het
Ap3d1 C T 10: 80,721,586 probably null Het
Appl2 A T 10: 83,600,991 D635E probably damaging Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atp10a T C 7: 58,791,095 M496T probably benign Het
Atp2c2 A G 8: 119,749,152 K595E probably damaging Het
Atpaf2 T C 11: 60,404,412 H204R probably damaging Het
Atr G A 9: 95,862,797 V56I probably benign Het
Bod1l G A 5: 41,833,663 T183I probably benign Het
Btbd11 A C 10: 85,654,550 I1027L probably damaging Het
Ccdc171 A T 4: 83,681,016 E689D probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Col22a1 T A 15: 71,801,925 T981S unknown Het
Col4a3bp T C 13: 96,612,265 V281A probably benign Het
Cpox G A 16: 58,672,623 A207T probably damaging Het
Cym G A 3: 107,216,097 T160I possibly damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddx4 C T 13: 112,613,696 probably null Het
Ddx4 A T 13: 112,651,360 V15E probably benign Het
Depdc1a G A 3: 159,526,636 E675K probably damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Dlg4 C T 11: 70,026,954 P21L probably damaging Het
Dmxl1 A T 18: 49,862,992 N395I probably damaging Het
Dzank1 A T 2: 144,504,399 C249S probably damaging Het
Efnb2 A T 8: 8,623,104 probably null Het
Ercc6l2 T G 13: 63,834,738 I244S probably damaging Het
Ewsr1 A T 11: 5,070,423 M584K unknown Het
Fam193b A G 13: 55,543,471 S197P probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo31 A T 8: 121,552,439 Y436* probably null Het
Fbxo31 A G 8: 121,552,441 Y436H probably damaging Het
Fcna T A 2: 25,625,326 D215V probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gcnt4 A T 13: 96,947,406 L403F possibly damaging Het
Gdf10 A G 14: 33,931,913 T126A probably benign Het
Ggcx A G 6: 72,428,892 K569E probably benign Het
Gm10250 C T 15: 5,121,096 probably benign Het
Gm8251 T C 1: 44,059,043 D965G possibly damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Ifi44 G A 3: 151,745,592 P241S probably damaging Het
Irs1 T C 1: 82,287,463 T1011A probably benign Het
Jag2 A T 12: 112,914,249 S595T probably benign Het
Kif5a T A 10: 127,230,954 Q960L probably benign Het
Kifc2 A G 15: 76,664,348 E430G possibly damaging Het
Lama3 T A 18: 12,411,570 C323* probably null Het
Lgsn T C 1: 31,203,742 Y302H probably benign Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrpap1 A G 5: 35,099,278 V120A probably damaging Het
Macrod2 T A 2: 140,419,938 D46E possibly damaging Het
Mbd4 C A 6: 115,845,322 R63L possibly damaging Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Ngb G A 12: 87,100,225 H73Y probably benign Het
Npepps G A 11: 97,226,826 T549I probably damaging Het
Nr1h2 A G 7: 44,550,499 V329A possibly damaging Het
Nsun6 T C 2: 15,036,326 I151M possibly damaging Het
Ofcc1 T C 13: 40,001,892 probably null Het
Olfr1388 T A 11: 49,443,869 F6Y probably benign Het
Olfr262 C T 19: 12,241,572 V30I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr391-ps C T 11: 73,798,839 C306Y probably benign Het
Olfr555 T A 7: 102,658,834 N4K possibly damaging Het
Olfr910 A G 9: 38,539,075 Y60C probably damaging Het
Parp6 A G 9: 59,634,984 probably null Het
Pcnt C A 10: 76,409,577 R1075S possibly damaging Het
Pla2g4f T C 2: 120,303,276 E548G probably damaging Het
Polrmt G T 10: 79,739,523 H725N probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Prtn3 C A 10: 79,882,065 P169H probably damaging Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprh A T 7: 4,569,577 H467Q probably benign Het
Raph1 A T 1: 60,489,114 I996N probably damaging Het
Rasa4 G A 5: 136,091,229 W53* probably null Het
Rasgrp1 C T 2: 117,284,875 R744Q probably benign Het
Rmnd5a T C 6: 71,413,349 E141G probably damaging Het
Rps12 T C 10: 23,786,790 I51M possibly damaging Het
Scn10a T G 9: 119,622,910 S1316R possibly damaging Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Setx G A 2: 29,144,046 R332Q probably damaging Het
Siglec1 A C 2: 131,075,923 S1011R probably damaging Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Slc11a1 T G 1: 74,384,088 L366R probably damaging Het
Slc12a1 C T 2: 125,161,079 R177* probably null Het
Slc30a1 A C 1: 191,909,048 K269Q probably benign Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Slf2 T A 19: 44,934,925 probably null Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spta1 A T 1: 174,230,666 Q1900L probably benign Het
Srgn C T 10: 62,497,852 E49K possibly damaging Het
Ssu2 A C 6: 112,376,450 C238G probably damaging Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Thra G A 11: 98,756,164 S37N probably benign Het
Toporsl A G 4: 52,610,845 D246G probably damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Usp10 A G 8: 119,941,191 Y77C probably benign Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r204 T G 13: 22,556,697 F166C probably benign Het
Vmn2r14 T C 5: 109,221,504 I68V probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Wsb1 A G 11: 79,240,373 M399T probably benign Het
Xbp1 C T 11: 5,521,167 T58M probably damaging Het
Zbtb46 A T 2: 181,391,136 D577E probably benign Het
Zfp366 A G 13: 99,246,483 D718G probably damaging Het
Zfp408 A T 2: 91,645,024 V595E possibly damaging Het
Zfp493 T A 13: 67,786,203 W60R probably null Het
Zfp606 A T 7: 12,494,005 K626N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Other mutations in Mfsd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Mfsd10 UTSW 5 34636637 unclassified probably null
R0226:Mfsd10 UTSW 5 34634446 missense probably benign 0.03
R0265:Mfsd10 UTSW 5 34635163 splice site probably benign
R1803:Mfsd10 UTSW 5 34636750 missense possibly damaging 0.81
R4235:Mfsd10 UTSW 5 34635625 missense probably damaging 0.99
R5861:Mfsd10 UTSW 5 34634244 unclassified probably benign
R6781:Mfsd10 UTSW 5 34634509 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AACATCTTGCCCTGCTGCAG -3'
(R):5'- ACAGGCATCTTCTGTCACC -3'

Sequencing Primer
(F):5'- TAGGCCACCAACTGCCTG -3'
(R):5'- TGGGCTTCCACACTGCTG -3'
Posted On2015-12-29