Incidental Mutation 'R0411:Setd1a'
ID36662
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
SynonymsKMT2F
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 127796051 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000206674]
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: V1263A
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: V1263A

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: V1263A
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: V1263A

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: V720A
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCCGGAAAACTGTTTCCTTCTC -3'
(R):5'- TGCTTTCTGAAGACTCGGACTCCTC -3'

Sequencing Primer
(F):5'- TGGTCCAGTCTCTCGAAAAG -3'
(R):5'- tcttcctcctcctcttctcc -3'
Posted On2013-05-09