Incidental Mutation 'R4782:Scn10a'
ID366622
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R4782 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119608456-119719322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119622910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1316 (S1316R)
Ref Sequence ENSEMBL: ENSMUSP00000150830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084787
AA Change: S1316R

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: S1316R

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213392
AA Change: S1315R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214408
AA Change: S1316R

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,328,096 E3092G probably damaging Het
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Abtb2 A T 2: 103,717,299 D1006V probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ahnak A G 19: 9,012,499 probably benign Het
Akap6 CA C 12: 52,887,623 probably null Het
Amotl2 T G 9: 102,720,123 probably null Het
Ankrd34b T A 13: 92,438,305 I15N probably damaging Het
Ap3d1 C T 10: 80,721,586 probably null Het
Appl2 A T 10: 83,600,991 D635E probably damaging Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atp10a T C 7: 58,791,095 M496T probably benign Het
Atp2c2 A G 8: 119,749,152 K595E probably damaging Het
Atpaf2 T C 11: 60,404,412 H204R probably damaging Het
Atr G A 9: 95,862,797 V56I probably benign Het
Bod1l G A 5: 41,833,663 T183I probably benign Het
Btbd11 A C 10: 85,654,550 I1027L probably damaging Het
Ccdc171 A T 4: 83,681,016 E689D probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Col22a1 T A 15: 71,801,925 T981S unknown Het
Col4a3bp T C 13: 96,612,265 V281A probably benign Het
Cpox G A 16: 58,672,623 A207T probably damaging Het
Cym G A 3: 107,216,097 T160I possibly damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddx4 C T 13: 112,613,696 probably null Het
Ddx4 A T 13: 112,651,360 V15E probably benign Het
Depdc1a G A 3: 159,526,636 E675K probably damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Dlg4 C T 11: 70,026,954 P21L probably damaging Het
Dmxl1 A T 18: 49,862,992 N395I probably damaging Het
Dzank1 A T 2: 144,504,399 C249S probably damaging Het
Efnb2 A T 8: 8,623,104 probably null Het
Ercc6l2 T G 13: 63,834,738 I244S probably damaging Het
Ewsr1 A T 11: 5,070,423 M584K unknown Het
Fam193b A G 13: 55,543,471 S197P probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo31 A T 8: 121,552,439 Y436* probably null Het
Fbxo31 A G 8: 121,552,441 Y436H probably damaging Het
Fcna T A 2: 25,625,326 D215V probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gcnt4 A T 13: 96,947,406 L403F possibly damaging Het
Gdf10 A G 14: 33,931,913 T126A probably benign Het
Ggcx A G 6: 72,428,892 K569E probably benign Het
Gm10250 C T 15: 5,121,096 probably benign Het
Gm8251 T C 1: 44,059,043 D965G possibly damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Ifi44 G A 3: 151,745,592 P241S probably damaging Het
Irs1 T C 1: 82,287,463 T1011A probably benign Het
Jag2 A T 12: 112,914,249 S595T probably benign Het
Kif5a T A 10: 127,230,954 Q960L probably benign Het
Kifc2 A G 15: 76,664,348 E430G possibly damaging Het
Lama3 T A 18: 12,411,570 C323* probably null Het
Lgsn T C 1: 31,203,742 Y302H probably benign Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrpap1 A G 5: 35,099,278 V120A probably damaging Het
Macrod2 T A 2: 140,419,938 D46E possibly damaging Het
Mbd4 C A 6: 115,845,322 R63L possibly damaging Het
Mfsd10 T C 5: 34,634,949 probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Ngb G A 12: 87,100,225 H73Y probably benign Het
Npepps G A 11: 97,226,826 T549I probably damaging Het
Nr1h2 A G 7: 44,550,499 V329A possibly damaging Het
Nsun6 T C 2: 15,036,326 I151M possibly damaging Het
Ofcc1 T C 13: 40,001,892 probably null Het
Olfr1388 T A 11: 49,443,869 F6Y probably benign Het
Olfr262 C T 19: 12,241,572 V30I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr391-ps C T 11: 73,798,839 C306Y probably benign Het
Olfr555 T A 7: 102,658,834 N4K possibly damaging Het
Olfr910 A G 9: 38,539,075 Y60C probably damaging Het
Parp6 A G 9: 59,634,984 probably null Het
Pcnt C A 10: 76,409,577 R1075S possibly damaging Het
Pla2g4f T C 2: 120,303,276 E548G probably damaging Het
Polrmt G T 10: 79,739,523 H725N probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Prtn3 C A 10: 79,882,065 P169H probably damaging Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprh A T 7: 4,569,577 H467Q probably benign Het
Raph1 A T 1: 60,489,114 I996N probably damaging Het
Rasa4 G A 5: 136,091,229 W53* probably null Het
Rasgrp1 C T 2: 117,284,875 R744Q probably benign Het
Rmnd5a T C 6: 71,413,349 E141G probably damaging Het
Rps12 T C 10: 23,786,790 I51M possibly damaging Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Setx G A 2: 29,144,046 R332Q probably damaging Het
Siglec1 A C 2: 131,075,923 S1011R probably damaging Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Slc11a1 T G 1: 74,384,088 L366R probably damaging Het
Slc12a1 C T 2: 125,161,079 R177* probably null Het
Slc30a1 A C 1: 191,909,048 K269Q probably benign Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Slf2 T A 19: 44,934,925 probably null Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spta1 A T 1: 174,230,666 Q1900L probably benign Het
Srgn C T 10: 62,497,852 E49K possibly damaging Het
Ssu2 A C 6: 112,376,450 C238G probably damaging Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Thra G A 11: 98,756,164 S37N probably benign Het
Toporsl A G 4: 52,610,845 D246G probably damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Usp10 A G 8: 119,941,191 Y77C probably benign Het
Utrn T C 10: 12,750,069 T123A probably damaging Het
Vmn1r204 T G 13: 22,556,697 F166C probably benign Het
Vmn2r14 T C 5: 109,221,504 I68V probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Wsb1 A G 11: 79,240,373 M399T probably benign Het
Xbp1 C T 11: 5,521,167 T58M probably damaging Het
Zbtb46 A T 2: 181,391,136 D577E probably benign Het
Zfp366 A G 13: 99,246,483 D718G probably damaging Het
Zfp408 A T 2: 91,645,024 V595E possibly damaging Het
Zfp493 T A 13: 67,786,203 W60R probably null Het
Zfp606 A T 7: 12,494,005 K626N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 missense probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense probably damaging 1.00
IGL01539:Scn10a APN 9 119638698 missense probably damaging 0.99
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 missense probably benign 0.09
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense possibly damaging 0.92
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 missense probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 splice site probably benign
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense probably benign 0.01
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.01
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense probably benign 0.01
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably damaging 1.00
R1945:Scn10a UTSW 9 119691454 missense possibly damaging 0.91
R2013:Scn10a UTSW 9 119613736 missense probably damaging 0.99
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2353:Scn10a UTSW 9 119638687 missense probably damaging 1.00
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.00
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.93
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense possibly damaging 0.46
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.63
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense possibly damaging 0.87
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense probably benign 0.25
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.01
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense possibly damaging 0.94
R6156:Scn10a UTSW 9 119635583 missense probably benign 0.00
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
R6711:Scn10a UTSW 9 119609913 missense probably damaging 1.00
R6751:Scn10a UTSW 9 119671551 missense probably damaging 1.00
R6877:Scn10a UTSW 9 119609782 missense probably damaging 0.96
R6909:Scn10a UTSW 9 119609790 missense probably damaging 1.00
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGTGCTGCCTCTTGTAG -3'
(R):5'- AAGGGACATTTGGGGATTTCAG -3'

Sequencing Primer
(F):5'- CTTATGGAAGAATCTGGAAGCTCC -3'
(R):5'- ACATTTGGGGATTTCAGGTCTTC -3'
Posted On2015-12-29