Incidental Mutation 'R4782:Utrn'
ID366623
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4782 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12750069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 123 (T123A)
Ref Sequence ENSEMBL: ENSMUSP00000151359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000217899] [ENSMUST00000218635] [ENSMUST00000219130] [ENSMUST00000219163] [ENSMUST00000219584] [ENSMUST00000219660]
Predicted Effect probably damaging
Transcript: ENSMUST00000076817
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: T123A

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217899
AA Change: T128A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218635
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219130
AA Change: T120A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219163
Predicted Effect probably damaging
Transcript: ENSMUST00000219584
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219660
AA Change: T123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,328,096 E3092G probably damaging Het
Abhd12b C G 12: 70,169,064 S170C probably damaging Het
Abtb2 A T 2: 103,717,299 D1006V probably benign Het
Adgrl1 A G 8: 83,935,573 H1021R probably benign Het
Ago3 A T 4: 126,347,872 probably null Het
Ahnak A G 19: 9,012,499 probably benign Het
Akap6 CA C 12: 52,887,623 probably null Het
Amotl2 T G 9: 102,720,123 probably null Het
Ankrd34b T A 13: 92,438,305 I15N probably damaging Het
Ap3d1 C T 10: 80,721,586 probably null Het
Appl2 A T 10: 83,600,991 D635E probably damaging Het
Arid1b C T 17: 5,339,221 P1681S probably damaging Het
Atp10a T C 7: 58,791,095 M496T probably benign Het
Atp2c2 A G 8: 119,749,152 K595E probably damaging Het
Atpaf2 T C 11: 60,404,412 H204R probably damaging Het
Atr G A 9: 95,862,797 V56I probably benign Het
Bod1l G A 5: 41,833,663 T183I probably benign Het
Btbd11 A C 10: 85,654,550 I1027L probably damaging Het
Ccdc171 A T 4: 83,681,016 E689D probably damaging Het
Cdc73 T A 1: 143,627,875 Q346L probably benign Het
Chd2 A T 7: 73,484,436 M721K possibly damaging Het
Col22a1 T A 15: 71,801,925 T981S unknown Het
Col4a3bp T C 13: 96,612,265 V281A probably benign Het
Cpox G A 16: 58,672,623 A207T probably damaging Het
Cym G A 3: 107,216,097 T160I possibly damaging Het
D130043K22Rik T C 13: 24,878,040 I664T probably damaging Het
Ddx4 C T 13: 112,613,696 probably null Het
Ddx4 A T 13: 112,651,360 V15E probably benign Het
Depdc1a G A 3: 159,526,636 E675K probably damaging Het
Dglucy A T 12: 100,850,343 M415L probably benign Het
Dlg4 C T 11: 70,026,954 P21L probably damaging Het
Dmxl1 A T 18: 49,862,992 N395I probably damaging Het
Dzank1 A T 2: 144,504,399 C249S probably damaging Het
Efnb2 A T 8: 8,623,104 probably null Het
Ercc6l2 T G 13: 63,834,738 I244S probably damaging Het
Ewsr1 A T 11: 5,070,423 M584K unknown Het
Fam193b A G 13: 55,543,471 S197P probably damaging Het
Fanca A G 8: 123,288,202 V689A probably damaging Het
Fbxo31 A T 8: 121,552,439 Y436* probably null Het
Fbxo31 A G 8: 121,552,441 Y436H probably damaging Het
Fcna T A 2: 25,625,326 D215V probably damaging Het
Foxj3 A T 4: 119,621,660 S438C unknown Het
Gcm2 T C 13: 41,103,494 K260E possibly damaging Het
Gcnt4 A T 13: 96,947,406 L403F possibly damaging Het
Gdf10 A G 14: 33,931,913 T126A probably benign Het
Ggcx A G 6: 72,428,892 K569E probably benign Het
Gm10250 C T 15: 5,121,096 probably benign Het
Gm8251 T C 1: 44,059,043 D965G possibly damaging Het
Gpnmb G T 6: 49,045,483 probably null Het
Ifi44 G A 3: 151,745,592 P241S probably damaging Het
Irs1 T C 1: 82,287,463 T1011A probably benign Het
Jag2 A T 12: 112,914,249 S595T probably benign Het
Kif5a T A 10: 127,230,954 Q960L probably benign Het
Kifc2 A G 15: 76,664,348 E430G possibly damaging Het
Lama3 T A 18: 12,411,570 C323* probably null Het
Lgsn T C 1: 31,203,742 Y302H probably benign Het
Lmbrd1 G A 1: 24,744,975 probably null Het
Lrpap1 A G 5: 35,099,278 V120A probably damaging Het
Macrod2 T A 2: 140,419,938 D46E possibly damaging Het
Mbd4 C A 6: 115,845,322 R63L possibly damaging Het
Mfsd10 T C 5: 34,634,949 probably benign Het
Mib2 G T 4: 155,659,772 S144R probably benign Het
Muc5b T A 7: 141,847,716 C566* probably null Het
Ndufs1 C A 1: 63,160,949 G268V probably damaging Het
Nfs1 A G 2: 156,134,449 V175A possibly damaging Het
Ngb G A 12: 87,100,225 H73Y probably benign Het
Npepps G A 11: 97,226,826 T549I probably damaging Het
Nr1h2 A G 7: 44,550,499 V329A possibly damaging Het
Nsun6 T C 2: 15,036,326 I151M possibly damaging Het
Ofcc1 T C 13: 40,001,892 probably null Het
Olfr1388 T A 11: 49,443,869 F6Y probably benign Het
Olfr262 C T 19: 12,241,572 V30I probably benign Het
Olfr372 A G 8: 72,058,094 N138S probably benign Het
Olfr391-ps C T 11: 73,798,839 C306Y probably benign Het
Olfr555 T A 7: 102,658,834 N4K possibly damaging Het
Olfr910 A G 9: 38,539,075 Y60C probably damaging Het
Parp6 A G 9: 59,634,984 probably null Het
Pcnt C A 10: 76,409,577 R1075S possibly damaging Het
Pla2g4f T C 2: 120,303,276 E548G probably damaging Het
Polrmt G T 10: 79,739,523 H725N probably benign Het
Pou2f3 T C 9: 43,139,858 T178A probably damaging Het
Prtn3 C A 10: 79,882,065 P169H probably damaging Het
Ptprd A G 4: 76,091,532 I764T probably benign Het
Ptprh A T 7: 4,569,577 H467Q probably benign Het
Raph1 A T 1: 60,489,114 I996N probably damaging Het
Rasa4 G A 5: 136,091,229 W53* probably null Het
Rasgrp1 C T 2: 117,284,875 R744Q probably benign Het
Rmnd5a T C 6: 71,413,349 E141G probably damaging Het
Rps12 T C 10: 23,786,790 I51M possibly damaging Het
Scn10a T G 9: 119,622,910 S1316R possibly damaging Het
Sdhb A G 4: 140,977,466 H246R possibly damaging Het
Setx G A 2: 29,144,046 R332Q probably damaging Het
Siglec1 A C 2: 131,075,923 S1011R probably damaging Het
Sin3b A C 8: 72,725,643 I126L probably benign Het
Slc11a1 T G 1: 74,384,088 L366R probably damaging Het
Slc12a1 C T 2: 125,161,079 R177* probably null Het
Slc30a1 A C 1: 191,909,048 K269Q probably benign Het
Slco1a5 T C 6: 142,248,807 Y370C possibly damaging Het
Slf2 T A 19: 44,934,925 probably null Het
Sltm A G 9: 70,589,057 H958R probably damaging Het
Snrnp40 A G 4: 130,362,756 I91M probably damaging Het
Spta1 A T 1: 174,230,666 Q1900L probably benign Het
Srgn C T 10: 62,497,852 E49K possibly damaging Het
Ssu2 A C 6: 112,376,450 C238G probably damaging Het
Terf2 G T 8: 107,076,675 H425Q probably benign Het
Thra G A 11: 98,756,164 S37N probably benign Het
Toporsl A G 4: 52,610,845 D246G probably damaging Het
Ubap2l G A 3: 90,020,903 T553M probably damaging Het
Usp10 A G 8: 119,941,191 Y77C probably benign Het
Vmn1r204 T G 13: 22,556,697 F166C probably benign Het
Vmn2r14 T C 5: 109,221,504 I68V probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Wsb1 A G 11: 79,240,373 M399T probably benign Het
Xbp1 C T 11: 5,521,167 T58M probably damaging Het
Zbtb46 A T 2: 181,391,136 D577E probably benign Het
Zfp366 A G 13: 99,246,483 D718G probably damaging Het
Zfp408 A T 2: 91,645,024 V595E possibly damaging Het
Zfp493 T A 13: 67,786,203 W60R probably null Het
Zfp606 A T 7: 12,494,005 K626N probably damaging Het
Zfp820 A T 17: 21,818,985 L454Q probably benign Het
Zswim5 A G 4: 116,972,972 I515V probably benign Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6919:Utrn UTSW 10 12693470 nonsense probably null
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGACACGAGGAGTTTG -3'
(R):5'- CGATGCTCTCATTGATCTGTAGG -3'

Sequencing Primer
(F):5'- GGAGTTTGAGGCAATAAACACC -3'
(R):5'- TGAGTTTTGCATTGATCCAATTCC -3'
Posted On2015-12-29