Incidental Mutation 'R0411:Ddx19b'
ID36667
Institutional Source Beutler Lab
Gene Symbol Ddx19b
Ensembl Gene ENSMUSG00000033658
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Synonyms
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0411 (G1)
Quality Score198
Status Not validated
Chromosome8
Chromosomal Location111003188-111031751 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 111023964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040241] [ENSMUST00000065784]
Predicted Effect probably null
Transcript: ENSMUST00000040241
SMART Domains Protein: ENSMUSP00000038551
Gene: ENSMUSG00000033658

DomainStartEndE-ValueType
Blast:DEXDc 5 44 1e-12 BLAST
low complexity region 45 55 N/A INTRINSIC
Blast:DEXDc 57 99 4e-11 BLAST
DEXDc 111 310 2.94e-42 SMART
HELICc 347 434 2.59e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065784
SMART Domains Protein: ENSMUSP00000066806
Gene: ENSMUSG00000033658

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
Blast:DEXDc 72 114 5e-11 BLAST
DEXDc 126 325 2.94e-42 SMART
HELICc 362 449 2.59e-29 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Ddx19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Ddx19b APN 8 111020988 missense probably damaging 1.00
IGL02089:Ddx19b APN 8 111008845 splice site probably benign
IGL02445:Ddx19b APN 8 111008824 missense probably damaging 1.00
IGL02756:Ddx19b APN 8 111011278 splice site probably benign
R0483:Ddx19b UTSW 8 111008678 missense probably benign 0.07
R1510:Ddx19b UTSW 8 111015653 missense probably damaging 1.00
R1797:Ddx19b UTSW 8 111012807 missense probably damaging 1.00
R1969:Ddx19b UTSW 8 111008258 missense probably benign 0.00
R1981:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R1982:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R3771:Ddx19b UTSW 8 111020981 missense probably benign 0.03
R4190:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4191:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4193:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R5132:Ddx19b UTSW 8 111022408 missense probably benign
R5435:Ddx19b UTSW 8 111008826 missense possibly damaging 0.67
Z1088:Ddx19b UTSW 8 111015575 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGCATCTTACCCCAAACTGAAGATGAAA -3'
(R):5'- GAACCCAACAGAGCAACCTAATGAGT -3'

Sequencing Primer
(F):5'- atctgcctgcctctgcc -3'
(R):5'- AGTCATTTTACTGAGTGCGCC -3'
Posted On2013-05-09