Incidental Mutation 'R4783:Thbs1'
ID366698
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 042416-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4783 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118114792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 282 (V282A)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably benign
Transcript: ENSMUST00000039559
AA Change: V282A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: V282A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148587
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik G A 5: 30,105,200 R54* probably null Het
Acsl6 A T 11: 54,336,993 M350L probably damaging Het
Adgrv1 T C 13: 81,095,445 T6279A probably damaging Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Ascc2 G A 11: 4,646,653 R58H probably benign Het
Brinp3 A G 1: 146,727,640 probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccdc47 T A 11: 106,203,604 H7L probably benign Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Cdr2 A T 7: 120,958,421 F294I probably benign Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Ctsll3 G A 13: 60,800,395 T156I probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Emsy T C 7: 98,646,479 N72S possibly damaging Het
Fam155a T C 8: 9,208,026 Y374C probably damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Flnb A T 14: 7,905,701 E1150D probably benign Het
Galt T C 4: 41,758,189 V318A probably damaging Het
Git1 T G 11: 77,499,837 L133R probably damaging Het
Gm11168 G A 9: 3,006,915 M213I probably benign Het
Gm7233 A G 14: 43,179,966 E25G probably benign Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
Hlcs C T 16: 94,268,539 V164I possibly damaging Het
Hmgcr G A 13: 96,666,193 T66M probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Lgals3bp G A 11: 118,393,514 T413I probably damaging Het
Lrrc7 A G 3: 158,127,213 probably null Het
Mapk11 T C 15: 89,149,488 Y9C probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Metrnl A G 11: 121,707,924 E40G probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myh13 A T 11: 67,341,270 I459F probably damaging Het
Nedd4l C A 18: 65,172,927 D424E probably damaging Het
Nid1 C T 13: 13,499,741 R902W probably damaging Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Numa1 A G 7: 102,013,566 T1997A probably damaging Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Nxf1 G A 19: 8,766,798 A339T probably benign Het
Oas1b C A 5: 120,814,513 Q90K probably benign Het
Olfr1175-ps A G 2: 88,323,156 I183T probably damaging Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr186 G T 16: 59,027,897 D3E probably benign Het
Olfr199 G T 16: 59,215,859 F251L probably damaging Het
Olfr398 A G 11: 73,984,008 F200S probably damaging Het
Olfr721-ps1 A C 14: 14,407,729 Y167S possibly damaging Het
Olfr998 A G 2: 85,590,938 T133A probably benign Het
Optn T C 2: 5,054,627 M27V probably benign Het
Oxgr1 T C 14: 120,022,364 I144V probably benign Het
Pax5 T A 4: 44,570,086 T127S probably damaging Het
Pcsk2 T C 2: 143,687,679 probably null Het
Pdxk A G 10: 78,464,792 V19A possibly damaging Het
Pik3c2a A T 7: 116,417,825 S232R probably damaging Het
Ppip5k1 T C 2: 121,340,848 D620G probably benign Het
Ppp4r4 T A 12: 103,590,858 probably null Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Psmd1 A G 1: 86,078,712 N267D probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rasal3 T A 17: 32,396,781 D361V probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Rbm6 T C 9: 107,852,903 D182G probably damaging Het
Rif1 T C 2: 52,112,747 V2071A probably damaging Het
Rilp C T 11: 75,510,641 A110V possibly damaging Het
Rprd2 A G 3: 95,774,333 V332A probably benign Het
Sbpl T A 17: 23,953,330 D205V unknown Het
Scn9a T C 2: 66,540,623 I538V probably benign Het
Serpina1d T C 12: 103,767,824 S74G possibly damaging Het
Serpina3n T C 12: 104,409,110 I147T possibly damaging Het
Serpinb8 A G 1: 107,604,742 N188S probably benign Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc25a47 T A 12: 108,855,334 L123Q probably damaging Het
Slc30a2 A T 4: 134,344,006 probably null Het
Snx13 T A 12: 35,098,286 D271E probably damaging Het
Tbc1d9b A G 11: 50,171,298 N1211S probably benign Het
Tdrd3 T A 14: 87,472,101 I67N probably damaging Het
Tmc8 A G 11: 117,791,605 probably null Het
Trim11 T A 11: 58,988,924 F300Y probably null Het
Ttn G T 2: 76,721,797 Y29419* probably null Het
Ttn A G 2: 76,769,603 Y19076H probably damaging Het
Ubr4 T C 4: 139,421,733 S448P possibly damaging Het
Ugt2b34 T C 5: 86,891,473 E443G probably damaging Het
Usp29 A G 7: 6,961,391 T78A probably damaging Het
Vmn1r227 A G 17: 20,735,134 noncoding transcript Het
Vmn1r85 A T 7: 13,084,861 W119R probably damaging Het
Vmn2r12 A T 5: 109,086,513 V611E probably damaging Het
Vmn2r97 A T 17: 18,929,288 M313L probably benign Het
Zap70 T C 1: 36,779,173 Y314H probably damaging Het
Zfp667 T A 7: 6,305,685 F451I possibly damaging Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2068:Thbs1 UTSW 2 118123537 nonsense probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTGAAACCTTGAATCAGC -3'
(R):5'- CTCCATTGTGAAAGCAGAGGGG -3'

Sequencing Primer
(F):5'- CCTTGAATCAGCTATCGAATACG -3'
(R):5'- AGCTCACTGACCAGCTCTCTG -3'
Posted On2015-12-29