Incidental Mutation 'R0411:Aqp9'
ID36674
Institutional Source Beutler Lab
Gene Symbol Aqp9
Ensembl Gene ENSMUSG00000032204
Gene Nameaquaporin 9
Synonyms1700020I22Rik
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0411 (G1)
Quality Score175
Status Validated
Chromosome9
Chromosomal Location71110659-71168682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71130444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 184 (V184L)
Ref Sequence ENSEMBL: ENSMUSP00000050127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060917] [ENSMUST00000074465] [ENSMUST00000113570] [ENSMUST00000144618]
Predicted Effect probably benign
Transcript: ENSMUST00000060917
AA Change: V184L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000050127
Gene: ENSMUSG00000032204
AA Change: V184L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:MIP 58 288 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074465
AA Change: V158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074063
Gene: ENSMUSG00000032204
AA Change: V158L

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113570
AA Change: V158L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204
AA Change: V158L

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144618
AA Change: V158L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116785
Gene: ENSMUSG00000032204
AA Change: V158L

DomainStartEndE-ValueType
Pfam:MIP 17 164 9.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213527
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes a member of the aquaglyceroporin subfamily of aquaporins. This protein transports water, glycerol, urea, purines and pyrimidines and plays a role in glycerol metabolism and osteoclast differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele have increased glycerol and triglyceride levels, increased resistance to glycerol-induced lysis, decreased glycerol permeability, and decreased susceptibility to the early stages of parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Aqp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Aqp9 APN 9 71132731 missense probably damaging 1.00
IGL01012:Aqp9 APN 9 71130549 splice site probably benign
IGL01667:Aqp9 APN 9 71138213 missense probably benign 0.13
IGL02225:Aqp9 APN 9 71130547 splice site probably benign
IGL02389:Aqp9 APN 9 71122906 missense possibly damaging 0.80
IGL02551:Aqp9 APN 9 71132640 missense probably damaging 0.98
IGL02904:Aqp9 APN 9 71138148 missense probably damaging 0.98
R0751:Aqp9 UTSW 9 71138205 missense probably damaging 1.00
R1656:Aqp9 UTSW 9 71138103 missense probably benign 0.01
R1731:Aqp9 UTSW 9 71122968 missense possibly damaging 0.91
R1733:Aqp9 UTSW 9 71112342 missense possibly damaging 0.67
R1865:Aqp9 UTSW 9 71112376 missense probably benign 0.29
R4058:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R4756:Aqp9 UTSW 9 71163049 missense probably damaging 1.00
R4771:Aqp9 UTSW 9 71122870 missense probably damaging 1.00
R4904:Aqp9 UTSW 9 71162403 intron probably benign
R5334:Aqp9 UTSW 9 71123010 critical splice acceptor site probably null
R5511:Aqp9 UTSW 9 71163093 utr 5 prime probably benign
R5771:Aqp9 UTSW 9 71122864 missense probably damaging 1.00
R6329:Aqp9 UTSW 9 71132684 nonsense probably null
R6831:Aqp9 UTSW 9 71162420 intron probably benign
R6838:Aqp9 UTSW 9 71112216 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCATCTTCAAGGGCAAACCACTG -3'
(R):5'- CTCAAGACCAAGCATGGGTCTCTG -3'

Sequencing Primer
(F):5'- CTGCCAAGAAAGCTCAGTTC -3'
(R):5'- cccctcaccctattcaaagtc -3'
Posted On2013-05-09