Incidental Mutation 'R0411:Izumo4'
ID36677
Institutional Source Beutler Lab
Gene Symbol Izumo4
Ensembl Gene ENSMUSG00000055862
Gene NameIZUMO family member 4
Synonyms
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80702184-80705373 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80703084 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 94 (Y94H)
Ref Sequence ENSEMBL: ENSMUSP00000151397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003438] [ENSMUST00000020420] [ENSMUST00000218090] [ENSMUST00000218184]
Predicted Effect probably benign
Transcript: ENSMUST00000003438
SMART Domains Protein: ENSMUSP00000003438
Gene: ENSMUSG00000003348

DomainStartEndE-ValueType
Mob1_phocein 34 208 6.02e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095426
AA Change: Y91H
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862
AA Change: Y91H

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218058
Predicted Effect probably benign
Transcript: ENSMUST00000218090
Predicted Effect probably damaging
Transcript: ENSMUST00000218184
AA Change: Y94H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000218330
AA Change: Y4H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219987
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Izumo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Izumo4 APN 10 80704198 unclassified probably benign
IGL03019:Izumo4 APN 10 80703846 unclassified probably benign
IGL03391:Izumo4 APN 10 80705113 missense probably damaging 0.97
F5770:Izumo4 UTSW 10 80703891 missense probably benign 0.02
IGL02835:Izumo4 UTSW 10 80705125 missense probably benign
R0304:Izumo4 UTSW 10 80702936 missense probably damaging 1.00
R0377:Izumo4 UTSW 10 80702840 missense probably damaging 1.00
R0498:Izumo4 UTSW 10 80704196 critical splice donor site probably null
R1822:Izumo4 UTSW 10 80703895 missense probably damaging 1.00
R1870:Izumo4 UTSW 10 80703735 missense probably damaging 1.00
R1977:Izumo4 UTSW 10 80703121 missense probably damaging 1.00
R2237:Izumo4 UTSW 10 80702830 missense probably damaging 1.00
R5288:Izumo4 UTSW 10 80702805 nonsense probably null
R5543:Izumo4 UTSW 10 80702834 missense probably damaging 1.00
R5587:Izumo4 UTSW 10 80703220 missense probably damaging 1.00
R6199:Izumo4 UTSW 10 80702873 missense probably damaging 1.00
R6222:Izumo4 UTSW 10 80703051 missense probably damaging 1.00
R6349:Izumo4 UTSW 10 80702717 start codon destroyed probably null 0.02
V7580:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7581:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7582:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7583:Izumo4 UTSW 10 80703891 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGTTGGAAGCATGATCAGGCCC -3'
(R):5'- CACTGCTCACTCTCTATGATGGCG -3'

Sequencing Primer
(F):5'- AGTGCGACCCCAATTTCG -3'
(R):5'- TTCTGGATGAGGCGCAC -3'
Posted On2013-05-09