Incidental Mutation 'R4784:Tenm4'
ID366836
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Nameteneurin transmembrane protein 4
SynonymsDoc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 041994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4784 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location96171246-96911093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96774046 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 683 (K683Q)
Ref Sequence ENSEMBL: ENSMUSP00000102783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
Predicted Effect probably benign
Transcript: ENSMUST00000107162
AA Change: K691Q

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: K691Q

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: K683Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: K683Q

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107166
AA Change: K646Q

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: K646Q

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,637,824 S83T probably damaging Het
Aff1 T A 5: 103,847,039 Y1034* probably null Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Asns T G 6: 7,678,029 K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Chaf1b T C 16: 93,884,542 V16A probably damaging Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dchs1 A G 7: 105,765,926 Y684H probably damaging Het
Dcun1d3 T C 7: 119,857,664 E275G probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dglucy A T 12: 100,838,664 D168V probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnajc17 T C 2: 119,179,428 D239G probably benign Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elavl2 T C 4: 91,254,142 R265G probably null Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Epha8 A T 4: 136,933,322 I695N probably damaging Het
Fam103a1 T A 7: 81,768,415 W73R probably damaging Het
Fam178b C A 1: 36,632,415 probably null Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fscn2 T C 11: 120,367,987 F453L possibly damaging Het
Gabrb2 T C 11: 42,597,642 C312R probably damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
H2-Q7 T G 17: 35,439,938 C122G probably damaging Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hes3 A G 4: 152,287,832 S37P probably damaging Het
Hs3st3b1 T C 11: 63,889,260 H347R probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Kcnc1 G T 7: 46,437,287 S570I probably benign Het
Kctd3 T C 1: 188,974,468 I523M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Krt83 A G 15: 101,487,956 S253P probably damaging Het
Ktn1 T A 14: 47,693,496 probably null Het
Lair1 T A 7: 4,009,732 M251L probably benign Het
Lama3 A T 18: 12,449,544 H631L probably benign Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrit1 C T 14: 37,062,236 T507M possibly damaging Het
Lrp11 A G 10: 7,604,201 H345R possibly damaging Het
Lrp6 A C 6: 134,479,539 S921A probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Marf1 A C 16: 14,152,457 S133A probably benign Het
Mga C T 2: 119,903,057 P129S probably damaging Het
Mgat4e T C 1: 134,541,325 N327S probably damaging Het
Mlh1 A G 9: 111,239,798 Y499H probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Naalad2 T C 9: 18,350,918 R442G probably damaging Het
Nat8f4 T C 6: 85,901,499 H14R probably benign Het
Nav1 A G 1: 135,458,739 S1184P probably damaging Het
Nckap1 T A 2: 80,506,934 N986I probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,746,402 probably benign Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr172 G T 16: 58,760,548 F209L probably damaging Het
Olfr675 A C 7: 105,024,530 I150S probably damaging Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Ppp1r14a A T 7: 29,292,061 E98V possibly damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prpf8 T A 11: 75,492,505 D521E probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc37a3 T G 6: 39,337,223 Q485P probably benign Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Tas2r125 A G 6: 132,909,903 I85V probably benign Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnip1 A C 11: 54,915,539 S570A possibly damaging Het
Top1mt G A 15: 75,657,703 P554S probably damaging Het
Top1mt A G 15: 75,676,031 F69L possibly damaging Het
Ttc7 A G 17: 87,340,897 K508R probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Xpo5 T C 17: 46,222,717 Y500H possibly damaging Het
Xpot C T 10: 121,615,063 probably null Het
Zbbx T C 3: 75,085,041 I268V probably benign Het
Zbtb40 G A 4: 137,007,097 P360S probably damaging Het
Zfp324 T C 7: 12,971,306 L474P probably damaging Het
Zfp398 A G 6: 47,840,252 T9A probably benign Het
Zfp692 A C 11: 58,310,171 S293R probably null Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 synonymous probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAATGAACCATCGCAG -3'
(R):5'- ATTCCACAGAGCAGGTTGG -3'

Sequencing Primer
(F):5'- GTTCACTACCAATCAACCGGTGTG -3'
(R):5'- CAGGTTGGCCTCTACCTTAGAG -3'
Posted On2015-12-29