Incidental Mutation 'R4784:Dchs1'
ID366839
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
MMRRC Submission 041994-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4784 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105765926 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 684 (Y684H)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: Y684H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: Y684H

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T A 14: 66,637,824 S83T probably damaging Het
Aff1 T A 5: 103,847,039 Y1034* probably null Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Asns T G 6: 7,678,029 K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Chaf1b T C 16: 93,884,542 V16A probably damaging Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dcun1d3 T C 7: 119,857,664 E275G probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dglucy A T 12: 100,838,664 D168V probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnajc17 T C 2: 119,179,428 D239G probably benign Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elavl2 T C 4: 91,254,142 R265G probably null Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Epha8 A T 4: 136,933,322 I695N probably damaging Het
Fam103a1 T A 7: 81,768,415 W73R probably damaging Het
Fam178b C A 1: 36,632,415 probably null Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fscn2 T C 11: 120,367,987 F453L possibly damaging Het
Gabrb2 T C 11: 42,597,642 C312R probably damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
H2-Q7 T G 17: 35,439,938 C122G probably damaging Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hes3 A G 4: 152,287,832 S37P probably damaging Het
Hs3st3b1 T C 11: 63,889,260 H347R probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Kcnc1 G T 7: 46,437,287 S570I probably benign Het
Kctd3 T C 1: 188,974,468 I523M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Krt83 A G 15: 101,487,956 S253P probably damaging Het
Ktn1 T A 14: 47,693,496 probably null Het
Lair1 T A 7: 4,009,732 M251L probably benign Het
Lama3 A T 18: 12,449,544 H631L probably benign Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrit1 C T 14: 37,062,236 T507M possibly damaging Het
Lrp11 A G 10: 7,604,201 H345R possibly damaging Het
Lrp6 A C 6: 134,479,539 S921A probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Marf1 A C 16: 14,152,457 S133A probably benign Het
Mga C T 2: 119,903,057 P129S probably damaging Het
Mgat4e T C 1: 134,541,325 N327S probably damaging Het
Mlh1 A G 9: 111,239,798 Y499H probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Naalad2 T C 9: 18,350,918 R442G probably damaging Het
Nat8f4 T C 6: 85,901,499 H14R probably benign Het
Nav1 A G 1: 135,458,739 S1184P probably damaging Het
Nckap1 T A 2: 80,506,934 N986I probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,746,402 probably benign Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr172 G T 16: 58,760,548 F209L probably damaging Het
Olfr675 A C 7: 105,024,530 I150S probably damaging Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Ppp1r14a A T 7: 29,292,061 E98V possibly damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prpf8 T A 11: 75,492,505 D521E probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc37a3 T G 6: 39,337,223 Q485P probably benign Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Tas2r125 A G 6: 132,909,903 I85V probably benign Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnip1 A C 11: 54,915,539 S570A possibly damaging Het
Top1mt G A 15: 75,657,703 P554S probably damaging Het
Top1mt A G 15: 75,676,031 F69L possibly damaging Het
Ttc7 A G 17: 87,340,897 K508R probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Xpo5 T C 17: 46,222,717 Y500H possibly damaging Het
Xpot C T 10: 121,615,063 probably null Het
Zbbx T C 3: 75,085,041 I268V probably benign Het
Zbtb40 G A 4: 137,007,097 P360S probably damaging Het
Zfp324 T C 7: 12,971,306 L474P probably damaging Het
Zfp398 A G 6: 47,840,252 T9A probably benign Het
Zfp692 A C 11: 58,310,171 S293R probably null Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTCAACAGCCCTGGAGAAG -3'
(R):5'- TCACGGTGACAGCTATCGATG -3'

Sequencing Primer
(F):5'- TCCTGGAAAGAGGAGACAATATTTAG -3'
(R):5'- CTATCGATGGGGTAAGTAAACAGACC -3'
Posted On2015-12-29