Incidental Mutation 'R0411:Ropn1'
ID36687
Institutional Source Beutler Lab
Gene Symbol Ropn1
Ensembl Gene ENSMUSG00000022832
Gene Nameropporin, rhophilin associated protein 1
SynonymsRHPNAP1, ropporin, ODF6, 1700008N21Rik
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34649921-34678618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34669964 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 62 (S62T)
Ref Sequence ENSEMBL: ENSMUSP00000023530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023530] [ENSMUST00000148562]
Predicted Effect probably benign
Transcript: ENSMUST00000023530
AA Change: S62T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023530
Gene: ENSMUSG00000022832
AA Change: S62T

DomainStartEndE-ValueType
PDB:2KYG|B 6 41 3e-6 PDB
SCOP:d1r2aa_ 10 44 5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148562
AA Change: S62T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122122
Gene: ENSMUSG00000022832
AA Change: S62T

DomainStartEndE-ValueType
Pfam:RIIa 12 43 2.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231612
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the fibrous sheath of spermatazoa, where it interacts with rhophilin, a Rho GTPase binding protein. The encoded protein also can bind an A-kinase anchoring protein (AKAP110) and a calcium-binding tyrosine phosphorylation-regulated protein (CABYR). This protein may be involved in sperm motility and has been shown to be a cancer-testis antigen in hematologic malignancies. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced sperm motility and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Ropn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Ropn1 APN 16 34678420 missense probably damaging 1.00
IGL01487:Ropn1 APN 16 34678469 missense probably damaging 1.00
IGL01610:Ropn1 APN 16 34666771 missense probably damaging 1.00
IGL01634:Ropn1 APN 16 34666771 missense probably damaging 1.00
IGL01634:Ropn1 APN 16 34666778 missense possibly damaging 0.95
IGL02125:Ropn1 APN 16 34666777 missense probably benign 0.32
IGL02312:Ropn1 APN 16 34677277 missense probably benign 0.01
R4249:Ropn1 UTSW 16 34678456 nonsense probably null
R4680:Ropn1 UTSW 16 34677305 missense possibly damaging 0.56
R5078:Ropn1 UTSW 16 34666791 missense probably damaging 1.00
R5440:Ropn1 UTSW 16 34671172 missense probably benign 0.00
R5441:Ropn1 UTSW 16 34666797 missense probably damaging 0.99
R6895:Ropn1 UTSW 16 34677298 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCCTACCAGATCCGCATGAATGG -3'
(R):5'- TTCTCTGAAGGACAAGTCGCTTTGAG -3'

Sequencing Primer
(F):5'- atcccagcaaccacacag -3'
(R):5'- CTTTGAGGCCAGGACTTAATAAGC -3'
Posted On2013-05-09