Incidental Mutation 'R4784:Adra1a'
ID366873
Institutional Source Beutler Lab
Gene Symbol Adra1a
Ensembl Gene ENSMUSG00000045875
Gene Nameadrenergic receptor, alpha 1a
SynonymsAdra1c
MMRRC Submission 041994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4784 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66635251-66771168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66637824 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 83 (S83T)
Ref Sequence ENSEMBL: ENSMUSP00000153103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054661] [ENSMUST00000159068] [ENSMUST00000159365] [ENSMUST00000161339] [ENSMUST00000225182]
Predicted Effect probably damaging
Transcript: ENSMUST00000054661
AA Change: S83T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053703
Gene: ENSMUSG00000045875
AA Change: S83T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 1.7e-80 PFAM
Pfam:7TM_GPCR_Srv 44 343 4.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159068
AA Change: S83T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124570
Gene: ENSMUSG00000045875
AA Change: S83T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159365
AA Change: S83T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124322
Gene: ENSMUSG00000045875
AA Change: S83T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 1.7e-17 PFAM
Pfam:7tm_1 43 326 1.8e-83 PFAM
Pfam:7TM_GPCR_Srv 44 343 7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160647
Predicted Effect probably damaging
Transcript: ENSMUST00000161339
AA Change: S83T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125354
Gene: ENSMUSG00000045875
AA Change: S83T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225182
AA Change: S83T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of several multipass transmembrane proteins that function as G protein-coupled receptors. The encoded protein binds to epinephrine and norepinephrine to mediate signaling in cells of the cardiac, nervous, and other organ systems. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mutations in this gene result in hypotension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T A 5: 103,847,039 Y1034* probably null Het
Ago3 A T 4: 126,368,503 M418K probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Arhgap32 A G 9: 32,129,653 D67G probably damaging Het
Arhgap32 T C 9: 32,260,780 C1619R probably damaging Het
Asns T G 6: 7,678,029 K350Q probably benign Het
Atp8b5 A T 4: 43,356,980 D576V probably damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
Baz1b T G 5: 135,217,413 L572R possibly damaging Het
C4b T C 17: 34,733,406 T1220A probably benign Het
Carmil3 T C 14: 55,501,321 probably null Het
Ccndbp1 A T 2: 121,008,522 T5S probably benign Het
Chaf1b T C 16: 93,884,542 V16A probably damaging Het
Chd8 C A 14: 52,205,368 C575F probably damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clip1 T C 5: 123,579,293 D1387G probably damaging Het
Col12a1 C A 9: 79,678,494 V1228F possibly damaging Het
Cxcr5 T C 9: 44,513,341 T340A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dchs1 A G 7: 105,765,926 Y684H probably damaging Het
Dcun1d3 T C 7: 119,857,664 E275G probably damaging Het
Dgcr8 G A 16: 18,258,310 R4* probably null Het
Dglucy A T 12: 100,838,664 D168V probably damaging Het
Dnah1 T A 14: 31,263,479 K3818N probably damaging Het
Dnajc17 T C 2: 119,179,428 D239G probably benign Het
Dok2 C T 14: 70,777,874 P347L probably benign Het
Elavl2 T C 4: 91,254,142 R265G probably null Het
Elf1 T A 14: 79,580,743 N567K probably benign Het
Epha8 A T 4: 136,933,322 I695N probably damaging Het
Fam103a1 T A 7: 81,768,415 W73R probably damaging Het
Fam178b C A 1: 36,632,415 probably null Het
Fam76a A T 4: 132,902,117 probably null Het
Fam76a A G 4: 132,916,190 Y78H probably damaging Het
Fbn1 A T 2: 125,324,919 C2026S probably damaging Het
Fbxo4 T C 15: 3,969,041 T312A probably benign Het
Fscn2 T C 11: 120,367,987 F453L possibly damaging Het
Gabrb2 T C 11: 42,597,642 C312R probably damaging Het
Gba2 A C 4: 43,568,315 L684R probably damaging Het
Golga2 T A 2: 32,297,156 N89K probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Grin1 T A 2: 25,292,381 H956L possibly damaging Het
H2-Q7 T G 17: 35,439,938 C122G probably damaging Het
Hcar2 C G 5: 123,864,450 G330A probably benign Het
Hes3 A G 4: 152,287,832 S37P probably damaging Het
Hs3st3b1 T C 11: 63,889,260 H347R probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Kcnc1 G T 7: 46,437,287 S570I probably benign Het
Kctd3 T C 1: 188,974,468 I523M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 T G 5: 123,816,762 M2081R possibly damaging Het
Krt83 A G 15: 101,487,956 S253P probably damaging Het
Ktn1 T A 14: 47,693,496 probably null Het
Lair1 T A 7: 4,009,732 M251L probably benign Het
Lama3 A T 18: 12,449,544 H631L probably benign Het
Lamc1 T C 1: 153,231,740 N1231S probably damaging Het
Lin54 A G 5: 100,459,738 I250T probably damaging Het
Lrit1 C T 14: 37,062,236 T507M possibly damaging Het
Lrp11 A G 10: 7,604,201 H345R possibly damaging Het
Lrp6 A C 6: 134,479,539 S921A probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Marf1 A C 16: 14,152,457 S133A probably benign Het
Mga C T 2: 119,903,057 P129S probably damaging Het
Mgat4e T C 1: 134,541,325 N327S probably damaging Het
Mlh1 A G 9: 111,239,798 Y499H probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Myo1h A G 5: 114,360,599 I919V possibly damaging Het
Naalad2 T C 9: 18,350,918 R442G probably damaging Het
Nat8f4 T C 6: 85,901,499 H14R probably benign Het
Nav1 A G 1: 135,458,739 S1184P probably damaging Het
Nckap1 T A 2: 80,506,934 N986I probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nop9 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 14: 55,746,402 probably benign Het
Nphp4 G A 4: 152,554,546 R878K probably benign Het
Nutm1 G A 2: 112,248,936 A878V probably benign Het
Olfr1305 A T 2: 111,873,050 D268E possibly damaging Het
Olfr172 G T 16: 58,760,548 F209L probably damaging Het
Olfr675 A C 7: 105,024,530 I150S probably damaging Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Ppp1r14a A T 7: 29,292,061 E98V possibly damaging Het
Pqlc2 G T 4: 139,300,001 H343Q probably benign Het
Prpf8 T A 11: 75,492,505 D521E probably damaging Het
Pudp A G 18: 50,568,065 V199A probably damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rbm12 T C 2: 156,096,564 D596G possibly damaging Het
Sipa1l3 A G 7: 29,377,641 V902A probably damaging Het
Slc37a3 T G 6: 39,337,223 Q485P probably benign Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sun3 G A 11: 9,038,266 L19F probably benign Het
Tas2r125 A G 6: 132,909,903 I85V probably benign Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tmprss11d C T 5: 86,306,281 V222M probably damaging Het
Tnip1 A C 11: 54,915,539 S570A possibly damaging Het
Top1mt G A 15: 75,657,703 P554S probably damaging Het
Top1mt A G 15: 75,676,031 F69L possibly damaging Het
Ttc7 A G 17: 87,340,897 K508R probably benign Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Xpo5 T C 17: 46,222,717 Y500H possibly damaging Het
Xpot C T 10: 121,615,063 probably null Het
Zbbx T C 3: 75,085,041 I268V probably benign Het
Zbtb40 G A 4: 137,007,097 P360S probably damaging Het
Zfp324 T C 7: 12,971,306 L474P probably damaging Het
Zfp398 A G 6: 47,840,252 T9A probably benign Het
Zfp692 A C 11: 58,310,171 S293R probably null Het
Other mutations in Adra1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Adra1a APN 14 66637873 missense probably damaging 1.00
IGL02751:Adra1a APN 14 66727532 missense possibly damaging 0.76
IGL02755:Adra1a APN 14 66727661 missense probably benign
IGL03367:Adra1a APN 14 66637989 missense possibly damaging 0.89
R0610:Adra1a UTSW 14 66637792 missense probably damaging 1.00
R0840:Adra1a UTSW 14 66727710 missense possibly damaging 0.73
R1720:Adra1a UTSW 14 66638278 missense probably damaging 1.00
R1902:Adra1a UTSW 14 66638235 missense probably benign 0.30
R2131:Adra1a UTSW 14 66727532 missense possibly damaging 0.76
R2198:Adra1a UTSW 14 66637936 missense probably damaging 1.00
R4702:Adra1a UTSW 14 66637559 start gained probably benign
R4761:Adra1a UTSW 14 66727431 splice site probably null
R4814:Adra1a UTSW 14 66638032 missense probably benign 0.01
R5844:Adra1a UTSW 14 66727734 missense probably benign 0.02
R7346:Adra1a UTSW 14 66638284 missense probably benign 0.16
Z1088:Adra1a UTSW 14 66727496 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGCTTCTGAAGGCTCCAAC -3'
(R):5'- TCCTCTGGGTGACAATGGTG -3'

Sequencing Primer
(F):5'- GCACAGGTGAACATTTCTAAGGCC -3'
(R):5'- CAATGGTGGGGTAGCGC -3'
Posted On2015-12-29