Incidental Mutation 'R4786:Dctn4'
ID367140
Institutional Source Beutler Lab
Gene Symbol Dctn4
Ensembl Gene ENSMUSG00000024603
Gene Namedynactin 4
Synonymsp62, 1110001K06Rik, 4930547K17Rik, C130039E17Rik
MMRRC Submission 041995-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4786 (G1)
Quality Score221
Status Not validated
Chromosome18
Chromosomal Location60526185-60558766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60555195 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000153008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025505] [ENSMUST00000223984]
Predicted Effect probably damaging
Transcript: ENSMUST00000025505
AA Change: D387G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025505
Gene: ENSMUSG00000024603
AA Change: D387G

DomainStartEndE-ValueType
Pfam:Dynactin_p62 23 172 4.8e-24 PFAM
Pfam:Dynactin_p62 125 378 8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223794
Predicted Effect probably damaging
Transcript: ENSMUST00000223984
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224671
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A T 12: 55,059,536 I134N possibly damaging Het
Acvr1c T C 2: 58,280,354 Y414C probably damaging Het
Adam32 A C 8: 24,863,493 S693R probably damaging Het
Aldh2 A T 5: 121,572,824 F314Y probably benign Het
Anks1 A G 17: 28,052,730 D874G possibly damaging Het
Ap4b1 T A 3: 103,818,804 V372E probably benign Het
Aqp12 G A 1: 93,006,455 C18Y probably damaging Het
Arap1 T A 7: 101,385,005 I218N possibly damaging Het
Arhgap42 C A 9: 9,238,698 E28* probably null Het
Asb5 G A 8: 54,585,839 E247K probably benign Het
Atg9b T C 5: 24,386,089 D781G possibly damaging Het
Atxn10 A G 15: 85,387,143 H294R probably benign Het
Bod1l G T 5: 41,819,438 T1511K probably benign Het
Btnl2 A T 17: 34,363,348 N296I probably damaging Het
Camta1 A T 4: 151,290,039 L168H probably damaging Het
Cant1 A T 11: 118,408,839 V265E possibly damaging Het
Ccdc157 T C 11: 4,151,861 D20G probably damaging Het
Cd209c T G 8: 3,945,698 T35P possibly damaging Het
Cdc20b G A 13: 113,078,734 V279M probably damaging Het
Cdh18 T A 15: 23,410,787 W453R probably null Het
Cdh24 A G 14: 54,637,550 S333P possibly damaging Het
Ceacam11 T C 7: 17,972,314 probably null Het
Ciz1 C T 2: 32,377,527 P150L probably damaging Het
Crip3 C A 17: 46,431,042 Q152K possibly damaging Het
Dars2 G A 1: 161,060,760 R197W probably damaging Het
Dido1 T C 2: 180,670,871 Y1077C possibly damaging Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egln3 A T 12: 54,185,581 I146N probably damaging Het
Eif2ak3 C T 6: 70,892,618 T763M possibly damaging Het
Etfbkmt A T 6: 149,147,246 M1L probably benign Het
Fam171a1 A T 2: 3,225,578 I583F probably damaging Het
Fbxo38 A C 18: 62,529,674 L249W probably damaging Het
Fxyd5 T C 7: 31,041,482 probably benign Het
Gabrr3 C A 16: 59,430,100 T154K probably benign Het
Gm7233 C A 14: 43,180,890 D90E probably benign Het
Gm8186 A G 17: 26,099,040 V61A probably benign Het
Gm9573 A T 17: 35,619,329 probably benign Het
Gnao1 A G 8: 93,944,303 I137V probably benign Het
Gnptab A G 10: 88,436,182 M945V probably damaging Het
Gpsm1 G A 2: 26,322,481 A78T probably benign Het
Gtf2b T C 3: 142,781,469 L222P probably damaging Het
Hnrnpf A G 6: 117,923,896 Y47C probably damaging Het
Itga6 A G 2: 71,838,690 N608S possibly damaging Het
Kdm2b T C 5: 122,880,854 probably null Het
Krit1 T A 5: 3,812,467 H207Q possibly damaging Het
Ky A G 9: 102,541,987 N398D probably benign Het
Lama1 T A 17: 67,773,859 V1294E possibly damaging Het
Lef1 C T 3: 131,111,524 T18I probably damaging Het
Lrp2 T C 2: 69,537,956 N178S probably damaging Het
Lrrc36 A G 8: 105,455,278 T525A probably benign Het
Map3k8 A T 18: 4,340,647 C222* probably null Het
Mapre2 G C 18: 23,877,959 S199T probably benign Het
Mcm3ap A G 10: 76,488,466 N911S probably benign Het
Mroh4 G T 15: 74,610,234 H722Q probably benign Het
Myo5b A C 18: 74,695,380 Y701S probably benign Het
Myt1l G T 12: 29,811,458 V80L unknown Het
Ncoa7 C A 10: 30,655,642 V24L probably benign Het
Nlrp10 A T 7: 108,925,238 V345D probably damaging Het
Nmral1 C A 16: 4,716,424 G51V probably damaging Het
Npc1 A G 18: 12,199,497 I797T probably benign Het
Olfr1269 A T 2: 90,119,007 I197N possibly damaging Het
Olfr936 T A 9: 39,047,487 R22* probably null Het
Olfr954 A T 9: 39,461,841 I134L probably benign Het
Pclo A T 5: 14,723,267 I4419F unknown Het
Phf3 C A 1: 30,816,557 E983* probably null Het
Pitpnm2 A T 5: 124,121,743 Y1149* probably null Het
Sdc3 A T 4: 130,822,768 T430S probably damaging Het
Sema3f A G 9: 107,682,682 V671A probably benign Het
Sigirr T G 7: 141,091,433 S379R probably benign Het
Slc25a23 T A 17: 57,047,326 N360I possibly damaging Het
Slco6c1 A T 1: 97,087,995 M357K probably benign Het
Sox14 C A 9: 99,874,965 M240I probably benign Het
Stradb A T 1: 58,991,208 probably benign Het
Szt2 A T 4: 118,399,062 M200K probably benign Het
Tef T C 15: 81,815,252 S85P probably benign Het
Thada T A 17: 84,458,855 H41L possibly damaging Het
Tinagl1 A G 4: 130,173,931 F90S probably benign Het
Tnfaip1 G A 11: 78,530,219 T5I possibly damaging Het
Tnfrsf23 A T 7: 143,680,064 V59D probably damaging Het
Tnpo3 A G 6: 29,578,542 V311A probably benign Het
Trak1 T A 9: 121,472,494 M772K probably benign Het
Ubash3a A G 17: 31,217,964 D185G probably benign Het
Vmn2r120 T C 17: 57,522,048 T516A probably benign Het
Wdr4 A C 17: 31,509,811 L130R probably damaging Het
Zfp12 T C 5: 143,245,502 I528T probably damaging Het
Zfp607a T C 7: 27,879,413 L636P probably damaging Het
Other mutations in Dctn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01939:Dctn4 APN 18 60544130 missense probably benign 0.12
R0040:Dctn4 UTSW 18 60544042 missense possibly damaging 0.71
R1406:Dctn4 UTSW 18 60556330 missense probably benign
R1406:Dctn4 UTSW 18 60556330 missense probably benign
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1464:Dctn4 UTSW 18 60538406 missense probably damaging 0.97
R1785:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R1786:Dctn4 UTSW 18 60546335 critical splice donor site probably null
R2035:Dctn4 UTSW 18 60538417 missense possibly damaging 0.91
R2064:Dctn4 UTSW 18 60538277 missense possibly damaging 0.60
R4020:Dctn4 UTSW 18 60538257 splice site probably benign
R4748:Dctn4 UTSW 18 60550236 missense probably damaging 1.00
R4976:Dctn4 UTSW 18 60556392 missense probably benign 0.00
R5034:Dctn4 UTSW 18 60552884 missense probably benign 0.23
R5110:Dctn4 UTSW 18 60546315 missense probably damaging 0.96
R6210:Dctn4 UTSW 18 60546793 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAGACCCTGTAAGGAGTATAGACG -3'
(R):5'- ACTCTGCCGTCTCACACAAG -3'

Sequencing Primer
(F):5'- CCCTGTAAGGAGTATAGACGTGTGC -3'
(R):5'- GTAGCCTTGTGCACTCATGTCAAAG -3'
Posted On2015-12-29