Incidental Mutation 'R0412:4932431P20Rik'
List |< first << previous [record 23 of 1871] next >> last >|
ID36716
Institutional Source Beutler Lab
Gene Symbol 4932431P20Rik
Ensembl Gene ENSMUSG00000074224
Gene NameRIKEN cDNA 4932431P20 gene
Synonyms
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R0412 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29519205-29538057 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to G at 29530570 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141713
SMART Domains Protein: ENSMUSP00000120285
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
Blast:WD40 94 134 1e-9 BLAST
WD40 139 176 1.59e1 SMART
WD40 228 269 9.51e1 SMART
WD40 272 311 3.33e-1 SMART
Blast:WD40 354 393 4e-15 BLAST
Blast:WD40 445 490 2e-22 BLAST
Blast:WD40 493 538 8e-15 BLAST
WD40 595 634 1.68e-6 SMART
low complexity region 701 710 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
coiled coil region 1135 1168 N/A INTRINSIC
low complexity region 1211 1230 N/A INTRINSIC
low complexity region 1239 1273 N/A INTRINSIC
coiled coil region 1347 1375 N/A INTRINSIC
coiled coil region 1399 1433 N/A INTRINSIC
low complexity region 1435 1453 N/A INTRINSIC
low complexity region 1497 1519 N/A INTRINSIC
coiled coil region 1612 1707 N/A INTRINSIC
coiled coil region 1731 1989 N/A INTRINSIC
coiled coil region 2034 2072 N/A INTRINSIC
coiled coil region 2127 2154 N/A INTRINSIC
coiled coil region 2220 2302 N/A INTRINSIC
coiled coil region 2357 2561 N/A INTRINSIC
low complexity region 2993 2999 N/A INTRINSIC
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Nckap1l A T 15: 103,464,652 S311C probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in 4932431P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:4932431P20Rik APN 7 29537622 exon noncoding transcript
IGL00505:4932431P20Rik APN 7 29534183 exon noncoding transcript
IGL00557:4932431P20Rik APN 7 29535802 exon noncoding transcript
IGL00569:4932431P20Rik APN 7 29534140 exon noncoding transcript
IGL00966:4932431P20Rik APN 7 29537463 exon noncoding transcript
IGL01668:4932431P20Rik APN 7 29537430 exon noncoding transcript
K7371:4932431P20Rik UTSW 7 29530992 exon noncoding transcript
P0037:4932431P20Rik UTSW 7 29533614 exon noncoding transcript
R0179:4932431P20Rik UTSW 7 29535940 exon noncoding transcript
R0357:4932431P20Rik UTSW 7 29535582 exon noncoding transcript
R0358:4932431P20Rik UTSW 7 29532211 exon noncoding transcript
R0530:4932431P20Rik UTSW 7 29530120 exon noncoding transcript
R0600:4932431P20Rik UTSW 7 29533265 exon noncoding transcript
R0675:4932431P20Rik UTSW 7 29532517 exon noncoding transcript
R1118:4932431P20Rik UTSW 7 29534244 exon noncoding transcript
R1395:4932431P20Rik UTSW 7 29531387 exon noncoding transcript
R1444:4932431P20Rik UTSW 7 29529955 exon noncoding transcript
R1476:4932431P20Rik UTSW 7 29534890 exon noncoding transcript
R1534:4932431P20Rik UTSW 7 29530429 exon noncoding transcript
R1535:4932431P20Rik UTSW 7 29529579 exon noncoding transcript
R2023:4932431P20Rik UTSW 7 29531534 exon noncoding transcript
R2127:4932431P20Rik UTSW 7 29537140 exon noncoding transcript
R2141:4932431P20Rik UTSW 7 29531510 exon noncoding transcript
R2198:4932431P20Rik UTSW 7 29527272 exon noncoding transcript
R2201:4932431P20Rik UTSW 7 29536525 exon noncoding transcript
R2262:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R2263:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R4874:4932431P20Rik UTSW 7 29536183 exon noncoding transcript
R5064:4932431P20Rik UTSW 7 29535655 exon noncoding transcript
R5130:4932431P20Rik UTSW 7 29529274 exon noncoding transcript
R5366:4932431P20Rik UTSW 7 29533539 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGACTGCCTGGGACGGATTGAAC -3'
(R):5'- GCATGGCCCATGATGCTGAGAATTG -3'

Sequencing Primer
(F):5'- GGATTGAACCCCTATCAGATACTTGG -3'
(R):5'- GAATTGCCTCGATCAGGCTAC -3'
Posted On2013-05-09