Incidental Mutation 'R4788:Map4k4'
ID367215
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40003916 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 644 (S644P)
Ref Sequence ENSEMBL: ENSMUSP00000141400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000191964] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably benign
Transcript: ENSMUST00000163854
AA Change: S644P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: S644P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168431
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191865
Predicted Effect probably benign
Transcript: ENSMUST00000191964
AA Change: S152P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141235
Gene: ENSMUSG00000026074
AA Change: S152P

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
SCOP:d1i7qa_ 35 139 7e-3 SMART
low complexity region 195 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192194
Predicted Effect unknown
Transcript: ENSMUST00000192355
AA Change: S154P
Predicted Effect unknown
Transcript: ENSMUST00000192509
AA Change: S590P
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: S590P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193682
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195259
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195356
Predicted Effect probably benign
Transcript: ENSMUST00000195636
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195860
AA Change: S644P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: S644P

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGAAAAGCTAGTTGTATGCAG -3'
(R):5'- TTGAAACTTCTGGCCCTTTAGC -3'

Sequencing Primer
(F):5'- GCTAGTTGTATGCAGAACGC -3'
(R):5'- GCCCTTTAGCCCTGATGAAGTAAG -3'
Posted On2015-12-29