Incidental Mutation 'R4788:Olfr1254'
ID367223
Institutional Source Beutler Lab
Gene Symbol Olfr1254
Ensembl Gene ENSMUSG00000075074
Gene Nameolfactory receptor 1254
SynonymsGA_x6K02T2Q125-51230155-51229211, MOR231-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89787325-89793619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89789136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 72 (S72F)
Ref Sequence ENSEMBL: ENSMUSP00000149507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099764] [ENSMUST00000111523] [ENSMUST00000216587]
Predicted Effect probably damaging
Transcript: ENSMUST00000099764
AA Change: S72F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097352
Gene: ENSMUSG00000075074
AA Change: S72F

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 9.7e-30 PFAM
Pfam:7tm_4 137 278 1.3e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111523
AA Change: S72F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107148
Gene: ENSMUSG00000075074
AA Change: S72F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.4e-46 PFAM
Pfam:7tm_1 39 285 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216587
AA Change: S72F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Olfr1254
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr1254 APN 2 89788785 missense probably damaging 1.00
IGL02822:Olfr1254 APN 2 89789100 missense possibly damaging 0.56
R1166:Olfr1254 UTSW 2 89789331 missense possibly damaging 0.74
R1639:Olfr1254 UTSW 2 89789245 missense probably damaging 1.00
R2248:Olfr1254 UTSW 2 89789180 missense possibly damaging 0.59
R2256:Olfr1254 UTSW 2 89788470 missense probably benign
R2351:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R4432:Olfr1254 UTSW 2 89788734 missense possibly damaging 0.76
R4649:Olfr1254 UTSW 2 89789293 missense probably benign 0.19
R6454:Olfr1254 UTSW 2 89789178 missense probably damaging 0.97
R6591:Olfr1254 UTSW 2 89788988 nonsense probably null
R6691:Olfr1254 UTSW 2 89788988 nonsense probably null
X0022:Olfr1254 UTSW 2 89788731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGGAGTGTGCAAACCCTC -3'
(R):5'- TCACTCAGGATCCTGTTGGC -3'

Sequencing Primer
(F):5'- TGCAAACCCGGTGATTCATG -3'
(R):5'- CTCAGGATCCTGTTGGCCAAAAAG -3'
Posted On2015-12-29