Incidental Mutation 'R4788:Tyrp1'
ID367231
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 80844943 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 356 (R356*)
Ref Sequence ENSEMBL: ENSMUSP00000099895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133932]
Predicted Effect probably null
Transcript: ENSMUST00000006151
AA Change: R356*
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: R356*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102831
AA Change: R356*
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: R356*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133932
SMART Domains Protein: ENSMUSP00000119167
Gene: ENSMUSG00000005994

DomainStartEndE-ValueType
Pfam:Tyrosinase 1 51 1e-12 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2440:Tyrp1 UTSW 4 80846606 missense probably benign 0.41
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTGCTCAGACCTATAGATATTC -3'
(R):5'- CTCATCGCCAAATGGAGTCTG -3'

Sequencing Primer
(F):5'- ATTCTTTAAGTACATTCCTTTCCTCC -3'
(R):5'- TGATACTCCCTTTATTTTTGAACCAG -3'
Posted On2015-12-29