Incidental Mutation 'R4788:Focad'
ID367233
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88357469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1105 (V1105E)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: V1191E
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: V1191E

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107148
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: V1105E
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: V1105E

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GATCCCCATCTAGAGCCTGTTG -3'
(R):5'- TCCCAGGAAGTGAGTCAGAC -3'

Sequencing Primer
(F):5'- CCATCTAGAGCCTGTTGTGAAAC -3'
(R):5'- TGAGTCAGACAGCAGCATGC -3'
Posted On2015-12-29