Incidental Mutation 'R4788:Cyp3a25'
ID367247
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 145985082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 347 (Y347*)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably null
Transcript: ENSMUST00000068317
AA Change: Y347*
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: Y347*

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153808
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAATTCCTGAGGCTCTGGC -3'
(R):5'- GACCACTCTTACCAGGATTCTC -3'

Sequencing Primer
(F):5'- CCAGTACTCAGGATTTCGGTGAAG -3'
(R):5'- ATCTGGCCAGGGGAGTATC -3'
Posted On2015-12-29