Incidental Mutation 'R4788:Olfr943'
ID367260
Institutional Source Beutler Lab
Gene Symbol Olfr943
Ensembl Gene ENSMUSG00000094970
Gene Nameolfactory receptor 943
SynonymsGA_x6K02T2PVTD-32881408-32882343, MOR171-44
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39166304-39192350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39184612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000071545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071617] [ENSMUST00000213176] [ENSMUST00000213507] [ENSMUST00000213830] [ENSMUST00000215770]
Predicted Effect probably benign
Transcript: ENSMUST00000071617
AA Change: T145A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071545
Gene: ENSMUSG00000094970
AA Change: T145A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 27 183 9.4e-7 PFAM
Pfam:7tm_4 34 311 7.4e-55 PFAM
Pfam:7tm_1 44 293 6.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213176
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213507
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213716
Predicted Effect probably benign
Transcript: ENSMUST00000213830
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215770
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Olfr943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr943 APN 9 39185092 missense possibly damaging 0.93
IGL02858:Olfr943 APN 9 39184526 missense probably damaging 1.00
IGL02890:Olfr943 APN 9 39184268 missense probably damaging 1.00
IGL02996:Olfr943 APN 9 39185065 missense probably damaging 1.00
R0334:Olfr943 UTSW 9 39184684 missense probably benign 0.01
R0881:Olfr943 UTSW 9 39184688 missense probably benign 0.00
R2474:Olfr943 UTSW 9 39184550 missense probably damaging 1.00
R3718:Olfr943 UTSW 9 39185065 missense probably damaging 1.00
R4358:Olfr943 UTSW 9 39184568 missense probably damaging 1.00
R4740:Olfr943 UTSW 9 39184368 nonsense probably null
R4763:Olfr943 UTSW 9 39184960 missense probably benign 0.15
R4824:Olfr943 UTSW 9 39184205 missense probably benign 0.02
R4866:Olfr943 UTSW 9 39185071 missense probably damaging 1.00
R5560:Olfr943 UTSW 9 39184184 missense probably benign 0.06
R6278:Olfr943 UTSW 9 39184298 missense probably damaging 1.00
R7003:Olfr943 UTSW 9 39184943 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCTTCCTGATGGAGAAGAAC -3'
(R):5'- AGTAATAACCGTTAGCAATGGGAC -3'

Sequencing Primer
(F):5'- TCCTGATGGAGAAGAACCTCATTTCC -3'
(R):5'- TGGGACACAGATATTCACTGTACC -3'
Posted On2015-12-29