Incidental Mutation 'R4788:Osbp2'
ID367262
Institutional Source Beutler Lab
Gene Symbol Osbp2
Ensembl Gene ENSMUSG00000020435
Gene Nameoxysterol binding protein 2
SynonymsOSBPL1, 1700095P05Rik, C630001G20Rik, ORP-4
Accession Numbers

Genbank: NM_152818; MGI: 1921559

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3703731-3863903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3863320 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 183 (K183R)
Ref Sequence ENSEMBL: ENSMUSP00000068652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070552]
Predicted Effect probably benign
Transcript: ENSMUST00000070552
AA Change: K183R

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068652
Gene: ENSMUSG00000020435
AA Change: K183R

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
PH 180 273 1.12e-16 SMART
low complexity region 281 311 N/A INTRINSIC
Blast:PH 312 394 1e-32 BLAST
low complexity region 424 437 N/A INTRINSIC
Pfam:Oxysterol_BP 519 894 3.5e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135250
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the oxysterol-binding protein-related family of proteins, which are defined by a C-terminal sterol domain with a highly conserved EQVSHHPP motif. Oxysterols are oxygenated derivatives of cholesterol that are involved in mechanisms that include apoptosis, cholesterol homeostasis, lipid trafficking and cell differentiation. This protein is selectively expressed at high levels in the brain and testis. Within the testis, the mRNA is localized to postmeiotic germ cells, including spermatids and spermatozoa, but is not detectable in somatic cells. Mice homozygous mutant for a targeted deletion in this gene do not exhibit overt developmental phenotypes but are male sterile. Females display normal fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with sperm defects including oligozoospermia, teratozoospermia, asthenozoospermia and abnormal spermiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Osbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Osbp2 APN 11 3711848 missense probably benign 0.02
IGL00231:Osbp2 APN 11 3726561 missense possibly damaging 0.79
IGL01023:Osbp2 APN 11 3863387 missense probably benign
IGL01819:Osbp2 APN 11 3717127 missense probably damaging 1.00
IGL01931:Osbp2 APN 11 3705388 critical splice donor site probably null
IGL01933:Osbp2 APN 11 3712016 missense probably damaging 1.00
IGL02166:Osbp2 APN 11 3717983 missense probably damaging 1.00
IGL02751:Osbp2 APN 11 3863434 missense probably benign 0.20
IGL02812:Osbp2 APN 11 3714637 missense probably benign 0.00
IGL03289:Osbp2 APN 11 3863380 missense probably benign
3-1:Osbp2 UTSW 11 3863470 missense probably benign 0.11
R0035:Osbp2 UTSW 11 3717997 splice site probably benign
R0109:Osbp2 UTSW 11 3711791 missense probably benign 0.00
R0414:Osbp2 UTSW 11 3819932 missense probably damaging 1.00
R0491:Osbp2 UTSW 11 3714709 missense probably damaging 1.00
R0791:Osbp2 UTSW 11 3711882 splice site probably benign
R1473:Osbp2 UTSW 11 3717175 unclassified probably null
R1630:Osbp2 UTSW 11 3717167 missense probably benign 0.15
R1931:Osbp2 UTSW 11 3726333 unclassified probably null
R2697:Osbp2 UTSW 11 3863407 missense probably benign 0.00
R3799:Osbp2 UTSW 11 3717883 missense probably damaging 1.00
R4700:Osbp2 UTSW 11 3712160 missense probably damaging 1.00
R4718:Osbp2 UTSW 11 3711793 missense probably damaging 0.98
R5381:Osbp2 UTSW 11 3705593 missense probably benign 0.12
R5615:Osbp2 UTSW 11 3863356 missense probably benign 0.00
R5681:Osbp2 UTSW 11 3863486 missense probably benign
R6171:Osbp2 UTSW 11 3717221 splice site probably null
R6329:Osbp2 UTSW 11 3715153 missense probably damaging 1.00
R6861:Osbp2 UTSW 11 3715191 missense possibly damaging 0.68
R6987:Osbp2 UTSW 11 3717958 missense probably damaging 0.99
R7205:Osbp2 UTSW 11 3712134 missense probably damaging 1.00
R7316:Osbp2 UTSW 11 3726431 missense probably damaging 1.00
X0060:Osbp2 UTSW 11 3820035 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATCTCAGAAGGGTTATGGTG -3'
(R):5'- TCAGAGAACGGCACAAGGTC -3'

Sequencing Primer
(F):5'- GTGACACCCACCCCACAGTC -3'
(R):5'- AGGTCTGTGTCCATCATCAAAGC -3'
Posted On2015-12-29