Incidental Mutation 'R4788:Tom1l2'
ID367266
Institutional Source Beutler Lab
Gene Symbol Tom1l2
Ensembl Gene ENSMUSG00000000538
Gene Nametarget of myb1-like 2 (chicken)
SynonymsA730055F12Rik, myb1-like protein 2, 2900016I08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60226714-60352905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60249018 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 275 (L275P)
Ref Sequence ENSEMBL: ENSMUSP00000099744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064019] [ENSMUST00000093046] [ENSMUST00000093048] [ENSMUST00000095254] [ENSMUST00000102682] [ENSMUST00000102683]
Predicted Effect probably damaging
Transcript: ENSMUST00000064019
AA Change: L275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063414
Gene: ENSMUSG00000000538
AA Change: L275P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093046
AA Change: L225P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090734
Gene: ENSMUSG00000000538
AA Change: L225P

DomainStartEndE-ValueType
Pfam:VHS 7 73 1.3e-19 PFAM
low complexity region 137 152 N/A INTRINSIC
Pfam:GAT 166 267 3e-36 PFAM
low complexity region 428 443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093048
AA Change: L230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090736
Gene: ENSMUSG00000000538
AA Change: L230P

DomainStartEndE-ValueType
VHS 13 154 1.8e-47 SMART
Pfam:GAT 171 272 3e-36 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095254
AA Change: L275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092884
Gene: ENSMUSG00000000538
AA Change: L275P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 2e-36 PFAM
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102682
AA Change: L275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099743
Gene: ENSMUSG00000000538
AA Change: L275P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 216 317 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102683
AA Change: L275P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099744
Gene: ENSMUSG00000000538
AA Change: L275P

DomainStartEndE-ValueType
VHS 13 148 1.88e-68 SMART
low complexity region 187 202 N/A INTRINSIC
Pfam:GAT 232 308 1e-26 PFAM
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133420
SMART Domains Protein: ENSMUSP00000117623
Gene: ENSMUSG00000000538

DomainStartEndE-ValueType
low complexity region 170 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142225
Predicted Effect probably benign
Transcript: ENSMUST00000143124
SMART Domains Protein: ENSMUSP00000121936
Gene: ENSMUSG00000000538

DomainStartEndE-ValueType
low complexity region 150 165 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele show malocclusion, kyphosis, hydrocephaly, patchy hair, splenomegaly, high B- and T-cell counts, thrombopenia, impaired humoral responses, a high frequency of infections and tumors, renal cysts, skin lesions, freezing behavior and sporadic bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Tom1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Tom1l2 APN 11 60261116 missense possibly damaging 0.93
IGL01459:Tom1l2 APN 11 60280269 missense probably damaging 1.00
IGL02990:Tom1l2 APN 11 60230236 missense probably damaging 1.00
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R0025:Tom1l2 UTSW 11 60230134 missense probably damaging 0.96
R4456:Tom1l2 UTSW 11 60352815 unclassified probably benign
R4627:Tom1l2 UTSW 11 60242707 critical splice donor site probably null
R4695:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4713:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4731:Tom1l2 UTSW 11 60270433 missense probably damaging 0.98
R4937:Tom1l2 UTSW 11 60258918 missense probably damaging 1.00
R5320:Tom1l2 UTSW 11 60242822 nonsense probably null
R5367:Tom1l2 UTSW 11 60241808 missense probably benign 0.00
R6158:Tom1l2 UTSW 11 60232927 missense probably damaging 1.00
R6944:Tom1l2 UTSW 11 60248991 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATCTCTGATGACTACTCCC -3'
(R):5'- CTGCACACGCCTGATTTTATG -3'

Sequencing Primer
(F):5'- TGATGACTACTCCCCACCTCTAAC -3'
(R):5'- GAACAAGCATGTACTCCTTCTGTGAC -3'
Posted On2015-12-29