Incidental Mutation 'R4788:Boc'
ID367279
Institutional Source Beutler Lab
Gene Symbol Boc
Ensembl Gene ENSMUSG00000022687
Gene Namebiregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44485049-44558897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44500433 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 288 (D288G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114634]
Predicted Effect probably damaging
Transcript: ENSMUST00000023370
AA Change: D288G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023370
Gene: ENSMUSG00000022687
AA Change: D288G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114634
AA Change: D288G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687
AA Change: D288G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Boc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Boc APN 16 44492955 missense probably benign 0.00
IGL00981:Boc APN 16 44491801 missense probably damaging 0.99
IGL01820:Boc APN 16 44491872 missense possibly damaging 0.88
IGL03114:Boc APN 16 44486752 missense probably benign 0.38
IGL03195:Boc APN 16 44492821 missense probably damaging 0.99
R0006:Boc UTSW 16 44496449 missense probably benign 0.41
R0142:Boc UTSW 16 44490241 missense probably damaging 1.00
R0417:Boc UTSW 16 44520234 missense probably benign 0.16
R1066:Boc UTSW 16 44490684 critical splice acceptor site probably null
R1248:Boc UTSW 16 44520473 missense probably benign 0.03
R1438:Boc UTSW 16 44488746 splice site probably null
R1506:Boc UTSW 16 44503565 missense probably damaging 1.00
R1729:Boc UTSW 16 44496419 missense probably benign 0.00
R1784:Boc UTSW 16 44496419 missense probably benign 0.00
R2004:Boc UTSW 16 44501644 critical splice donor site probably null
R2441:Boc UTSW 16 44488623 missense probably damaging 1.00
R2863:Boc UTSW 16 44492960 missense probably benign 0.03
R3885:Boc UTSW 16 44487613 splice site probably benign
R4201:Boc UTSW 16 44490618 missense probably damaging 1.00
R4239:Boc UTSW 16 44491884 missense probably damaging 1.00
R4382:Boc UTSW 16 44491182 missense probably damaging 1.00
R4384:Boc UTSW 16 44491182 missense probably damaging 1.00
R4385:Boc UTSW 16 44491182 missense probably damaging 1.00
R4684:Boc UTSW 16 44500380 missense probably benign 0.07
R4776:Boc UTSW 16 44487721 missense probably damaging 0.99
R4830:Boc UTSW 16 44490157 missense probably damaging 1.00
R5000:Boc UTSW 16 44490154 missense probably damaging 1.00
R5567:Boc UTSW 16 44492824 missense probably damaging 1.00
R5570:Boc UTSW 16 44492824 missense probably damaging 1.00
R5645:Boc UTSW 16 44499661 missense probably damaging 0.99
R5651:Boc UTSW 16 44521195 missense probably benign 0.00
R5881:Boc UTSW 16 44490651 missense probably damaging 1.00
R6021:Boc UTSW 16 44488654 missense probably benign 0.00
R6085:Boc UTSW 16 44488607 missense probably damaging 1.00
R6188:Boc UTSW 16 44499548 missense possibly damaging 0.67
R6295:Boc UTSW 16 44492348 missense probably benign 0.05
R6366:Boc UTSW 16 44487652 missense probably benign 0.04
R6626:Boc UTSW 16 44520440 missense possibly damaging 0.47
R6629:Boc UTSW 16 44492361 missense probably benign 0.11
R6707:Boc UTSW 16 44500616 missense possibly damaging 0.71
R6819:Boc UTSW 16 44492825 missense probably damaging 0.99
R6904:Boc UTSW 16 44491791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTAGAAACCTTTCGAGTTAGG -3'
(R):5'- AAGCCCAGACCGTCATTGTC -3'

Sequencing Primer
(F):5'- AGCCAGTATTCTGCTAGCAG -3'
(R):5'- GTCATTGTCACCAAAGGCCAGAG -3'
Posted On2015-12-29