Incidental Mutation 'R4788:Cybb'
ID367287
Institutional Source Beutler Lab
Gene Symbol Cybb
Ensembl Gene ENSMUSG00000015340
Gene Namecytochrome b-245, beta polypeptide
Synonymsgp91phox, gp91, Cgd, Nox2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4788 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location9435252-9487771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 9450750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 246 (D246H)
Ref Sequence ENSEMBL: ENSMUSP00000015484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015484] [ENSMUST00000164685]
Predicted Effect probably benign
Transcript: ENSMUST00000015484
AA Change: D246H

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015484
Gene: ENSMUSG00000015340
AA Change: D246H

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Ferric_reduct 54 220 8.4e-29 PFAM
Pfam:FAD_binding_6 292 395 1.6e-7 PFAM
Pfam:FAD_binding_8 292 395 1e-24 PFAM
Pfam:NAD_binding_6 401 551 5.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154503
Predicted Effect probably benign
Transcript: ENSMUST00000164685
SMART Domains Protein: ENSMUSP00000128963
Gene: ENSMUSG00000015340

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the heavy chain component of a heterodimeric transmembrane ion transporter composed of both a heavy and a light chain. This transporter mediates the transfer of electrons from nicotinamide adenine dinucleotide phosphate (NADPH) to oxygen to generate superoxide. This reaction is important in the innate immune response to pathogens. However, increased activity of the encoded protein also leads to the generation of reactive oxygen species that result in oxidative stress and can cause tissue damage. Conversely, loss of function of the related gene in human causes chronic granulomatous disease. Alternative splicing results in multiple transcript variants, although the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
PHENOTYPE: Nullizygous mice show alterations in acute inflammation, synaptic plasticity, memory, metastatic potential, susceptibility to infection and induced GI injury, inflammatory response to chemical peritonitis, vascular response to Ang II, hypoxia-induced LV remodeling, and L-NAME-caused renal responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,475 I128K probably damaging Het
Abca4 G A 3: 122,166,712 D815N probably damaging Het
Abcc9 A T 6: 142,620,730 C1135* probably null Het
Ap3b1 G A 13: 94,565,641 M1067I unknown Het
Arhgap15 T C 2: 43,748,890 M1T probably null Het
Boc T C 16: 44,500,433 D288G probably damaging Het
Brsk1 G T 7: 4,698,955 probably null Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Capn13 A T 17: 73,337,432 Y367* probably null Het
Ccdc191 A G 16: 43,956,822 E632G probably damaging Het
Cit T C 5: 115,933,506 S591P probably damaging Het
Ckmt1 T C 2: 121,359,946 V118A possibly damaging Het
Cndp2 T C 18: 84,675,164 N157S probably damaging Het
Col6a3 A G 1: 90,772,950 probably null Het
Coq2 A T 5: 100,657,909 V287E probably damaging Het
Cpa6 T C 1: 10,408,277 K278R possibly damaging Het
Cyp3a25 A T 5: 145,985,082 Y347* probably null Het
Dcun1d4 G T 5: 73,534,628 W160L probably damaging Het
Dennd4c A G 4: 86,819,963 T994A probably benign Het
Dhx57 T C 17: 80,275,331 T229A probably benign Het
Dnah6 T A 6: 73,129,530 R1741S probably damaging Het
Dock1 T A 7: 135,145,484 V1508D probably damaging Het
Donson T C 16: 91,687,833 T117A possibly damaging Het
Dtnb A G 12: 3,772,699 D533G probably damaging Het
Fcrl5 A G 3: 87,457,188 N470S probably damaging Het
Focad T A 4: 88,357,469 V1105E unknown Het
Fry T C 5: 150,399,636 V1084A probably benign Het
Gabra1 G T 11: 42,147,153 R213S probably damaging Het
Gbp2b A C 3: 142,611,410 K509T probably benign Het
Gprc6a T C 10: 51,615,008 T811A probably benign Het
Hmgcs2 A G 3: 98,291,084 D101G probably damaging Het
Ifna11 G A 4: 88,820,008 W17* probably null Het
Ighv1-62-3 T A 12: 115,461,052 M100L probably benign Het
Lgmn T A 12: 102,402,677 Y181F probably benign Het
Map4k4 T C 1: 40,003,916 S644P probably benign Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Nav1 C T 1: 135,469,723 A903T probably benign Het
Nop53 T C 7: 15,942,315 E153G possibly damaging Het
Nop56 G T 2: 130,278,900 V190L probably benign Het
Nyap2 A T 1: 81,269,397 M687L probably benign Het
Olfr1254 G A 2: 89,789,136 S72F probably damaging Het
Olfr146 T C 9: 39,018,921 T207A probably benign Het
Olfr943 A G 9: 39,184,612 T145A probably benign Het
Osbp2 T C 11: 3,863,320 K183R probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pax1 A G 2: 147,366,204 Q244R possibly damaging Het
Pcdh9 C A 14: 93,887,415 V317F probably damaging Het
Pkhd1l1 A T 15: 44,498,021 Q489L probably damaging Het
Poln A T 5: 34,129,331 S164R probably benign Het
Ptf1a T C 2: 19,445,951 S31P probably benign Het
Rasal3 A T 17: 32,399,338 D164E probably benign Het
Rnf170 A G 8: 26,140,863 E168G probably damaging Het
Rubcn A G 16: 32,836,408 probably null Het
Sec16b A T 1: 157,561,524 T830S possibly damaging Het
Sel1l3 A G 5: 53,131,833 V882A probably benign Het
Sfpq A G 4: 127,025,998 E512G probably damaging Het
Sh3pxd2a A G 19: 47,314,079 L187P probably damaging Het
Skint6 C T 4: 113,238,336 G42D possibly damaging Het
Slc7a2 A G 8: 40,913,986 I526V probably benign Het
Spata48 T C 11: 11,488,652 probably null Het
Ssh2 A T 11: 77,429,798 N328Y probably damaging Het
Taok2 G A 7: 126,868,132 S167L possibly damaging Het
Tcrg-V5 A G 13: 19,192,554 K57R probably benign Het
Tom1l2 A G 11: 60,249,018 L275P probably damaging Het
Tyrp1 C T 4: 80,844,943 R356* probably null Het
Zan A G 5: 137,442,113 L1953P unknown Het
Zfhx3 T C 8: 108,794,210 S655P probably damaging Het
Zmym1 T C 4: 127,054,297 T94A probably benign Het
Other mutations in Cybb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Cybb APN X 9446744 missense possibly damaging 0.46
IGL02145:Cybb APN X 9457018 missense probably damaging 1.00
IGL02626:Cybb APN X 9469200 splice site probably null
IGL02644:Cybb APN X 9467156 missense probably benign 0.00
IGL02869:Cybb APN X 9442589 missense probably benign 0.00
IGL03145:Cybb APN X 9453653 nonsense probably null
R3978:Cybb UTSW X 9444588 missense probably damaging 1.00
R3980:Cybb UTSW X 9444588 missense probably damaging 1.00
R4758:Cybb UTSW X 9450750 missense probably benign 0.10
R4761:Cybb UTSW X 9450750 missense probably benign 0.10
R4787:Cybb UTSW X 9450750 missense probably benign 0.10
R4793:Cybb UTSW X 9450750 missense probably benign 0.10
R4847:Cybb UTSW X 9450750 missense probably benign 0.10
R4901:Cybb UTSW X 9450750 missense probably benign 0.10
R4902:Cybb UTSW X 9450750 missense probably benign 0.10
R4904:Cybb UTSW X 9450750 missense probably benign 0.10
R4914:Cybb UTSW X 9450750 missense probably benign 0.10
R4915:Cybb UTSW X 9450750 missense probably benign 0.10
R4916:Cybb UTSW X 9450750 missense probably benign 0.10
R5058:Cybb UTSW X 9450750 missense probably benign 0.10
R5246:Cybb UTSW X 9450750 missense probably benign 0.10
R5416:Cybb UTSW X 9450750 missense probably benign 0.10
R5519:Cybb UTSW X 9450750 missense probably benign 0.10
R5538:Cybb UTSW X 9450750 missense probably benign 0.10
R5539:Cybb UTSW X 9450750 missense probably benign 0.10
R5576:Cybb UTSW X 9450750 missense probably benign 0.10
R5578:Cybb UTSW X 9450750 missense probably benign 0.10
R5728:Cybb UTSW X 9450750 missense probably benign 0.10
R5729:Cybb UTSW X 9450750 missense probably benign 0.10
R5761:Cybb UTSW X 9450750 missense probably benign 0.10
R5762:Cybb UTSW X 9450750 missense probably benign 0.10
R5927:Cybb UTSW X 9450750 missense probably benign 0.10
R6057:Cybb UTSW X 9450750 missense probably benign 0.10
R6086:Cybb UTSW X 9450750 missense probably benign 0.10
R6144:Cybb UTSW X 9450750 missense probably benign 0.10
R6147:Cybb UTSW X 9450750 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCCCACATGTCCTGGTTTGG -3'
(R):5'- GGCTCACATGAAGATATTTGCG -3'

Sequencing Primer
(F):5'- CTTCTCAACTTGACACATGCTAGAG -3'
(R):5'- TTGCGATATGTGCACAATCAG -3'
Posted On2015-12-29