Incidental Mutation 'R4789:Dock10'
ID367291
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80541281 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1241 (H1241L)
Ref Sequence ENSEMBL: ENSMUSP00000140719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably damaging
Transcript: ENSMUST00000077946
AA Change: H1254L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: H1254L

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187774
AA Change: H1242L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: H1242L

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190595
AA Change: H907L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: H907L

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190983
AA Change: H1241L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: H1241L

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGCATGGTGTACTTTGCC -3'
(R):5'- CTGTGAACATAACTATGCTCTTCAC -3'

Sequencing Primer
(F):5'- GTGTACTTTGCCAGGTATATTATGC -3'
(R):5'- GCCAACTTTAGTGGAACATCTTTGC -3'
Posted On2015-12-29