Incidental Mutation 'R4789:Bok'
ID367292
Institutional Source Beutler Lab
Gene Symbol Bok
Ensembl Gene ENSMUSG00000026278
Gene NameBCL2-related ovarian killer
Synonymsmtd, matador
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93685660-93695764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93689241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000140412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027499] [ENSMUST00000188394] [ENSMUST00000201863]
Predicted Effect probably damaging
Transcript: ENSMUST00000027499
AA Change: V103A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027499
Gene: ENSMUSG00000026278
AA Change: V103A

DomainStartEndE-ValueType
BCL 71 172 6.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185685
Predicted Effect probably damaging
Transcript: ENSMUST00000188394
AA Change: V103A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140412
Gene: ENSMUSG00000026278
AA Change: V103A

DomainStartEndE-ValueType
Pfam:Bcl-2 71 121 8.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200888
AA Change: V11A

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000201863
AA Change: V103A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144347
Gene: ENSMUSG00000026278
AA Change: V103A

DomainStartEndE-ValueType
BCL 71 172 6.99e-37 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 family, members of which form homo- or heterodimers, and act as anti- or proapoptotic regulators that are involved in a wide variety of cellular processes. Studies in rat show that this protein has restricted expression in reproductive tissues, interacts strongly with some antiapoptotic BCL2 proteins, not at all with proapoptotic BCL2 proteins, and induces apoptosis in transfected cells. Thus, this protein represents a proapoptotic member of the BCL2 family. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit minor increase in spleen and thymus weight in female, but not male, mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Bok
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Bok APN 1 93686675 splice site probably benign
R0135:Bok UTSW 1 93686507 missense probably damaging 1.00
R0153:Bok UTSW 1 93686517 missense probably damaging 1.00
R0464:Bok UTSW 1 93694213 missense probably damaging 1.00
R0485:Bok UTSW 1 93689277 missense probably damaging 1.00
R0883:Bok UTSW 1 93686487 missense probably benign 0.44
R2177:Bok UTSW 1 93695065 nonsense probably null
R4612:Bok UTSW 1 93694178 missense probably damaging 1.00
R7077:Bok UTSW 1 93689189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGCTAGCTTGGAGGTC -3'
(R):5'- AGAACAGCCTCAAGTGTCAGG -3'

Sequencing Primer
(F):5'- CAAGTGGGGTCAGGTGGATC -3'
(R):5'- CCTCAAGTGTCAGGAGGCATG -3'
Posted On2015-12-29