Incidental Mutation 'R4789:Zkscan14'
ID367309
Institutional Source Beutler Lab
Gene Symbol Zkscan14
Ensembl Gene ENSMUSG00000029627
Gene Namezinc finger with KRAB and SCAN domains 14
Synonyms2810437E14Rik, 2310046C23Rik, Zfp99
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145194946-145201868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145195634 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 362 (K362N)
Ref Sequence ENSEMBL: ENSMUSP00000031632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031632] [ENSMUST00000037056] [ENSMUST00000161741] [ENSMUST00000162220] [ENSMUST00000162360] [ENSMUST00000198959]
Predicted Effect probably damaging
Transcript: ENSMUST00000031632
AA Change: K362N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031632
Gene: ENSMUSG00000029627
AA Change: K362N

DomainStartEndE-ValueType
SCAN 40 152 6.65e-65 SMART
KRAB 135 196 2.79e-13 SMART
low complexity region 258 269 N/A INTRINSIC
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 4.01e-5 SMART
ZnF_C2H2 383 405 1.04e-3 SMART
ZnF_C2H2 411 432 2.82e0 SMART
ZnF_C2H2 438 460 4.54e-4 SMART
ZnF_C2H2 466 488 1.95e-3 SMART
ZnF_C2H2 494 516 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037056
SMART Domains Protein: ENSMUSP00000039726
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 1 73 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161741
SMART Domains Protein: ENSMUSP00000125504
Gene: ENSMUSG00000038690

DomainStartEndE-ValueType
Pfam:WRW 6 84 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161845
Predicted Effect possibly damaging
Transcript: ENSMUST00000162220
AA Change: K228N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124196
Gene: ENSMUSG00000029627
AA Change: K228N

DomainStartEndE-ValueType
KRAB 1 62 2.79e-13 SMART
low complexity region 124 135 N/A INTRINSIC
ZnF_C2H2 193 215 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162360
Predicted Effect probably benign
Transcript: ENSMUST00000198959
SMART Domains Protein: ENSMUSP00000143630
Gene: ENSMUSG00000029627

DomainStartEndE-ValueType
SCAN 40 143 4.29e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200584
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein that inhibits the transcription of mitogen-activated protein kinase signaling pathways. The encoded protein may be involved in cardiac function. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Other mutations in Zkscan14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Zkscan14 APN 5 145195996 missense probably benign 0.13
IGL02005:Zkscan14 APN 5 145195609 missense probably benign 0.03
R1672:Zkscan14 UTSW 5 145201654 missense probably benign 0.02
R2166:Zkscan14 UTSW 5 145196134 missense probably benign 0.00
R4169:Zkscan14 UTSW 5 145196175 missense possibly damaging 0.55
R4853:Zkscan14 UTSW 5 145195191 missense probably benign 0.05
R4959:Zkscan14 UTSW 5 145195492 missense probably benign 0.00
R5391:Zkscan14 UTSW 5 145195794 missense probably benign 0.00
R5457:Zkscan14 UTSW 5 145201359 missense probably benign 0.00
R6752:Zkscan14 UTSW 5 145195506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAACAGGCTGGAAACATG -3'
(R):5'- AAGGTTTCCATGTGAAATGCC -3'

Sequencing Primer
(F):5'- GGCTGGAAACATGAACGATCTCC -3'
(R):5'- TGTGAAATGCCATTCAGTGAAGCC -3'
Posted On2015-12-29