Incidental Mutation 'R4789:Dlat'
ID367325
Institutional Source Beutler Lab
Gene Symbol Dlat
Ensembl Gene ENSMUSG00000000168
Gene Namedihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
SynonymsPDC-E2, 6332404G05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4789 (G1)
Quality Score201
Status Not validated
Chromosome9
Chromosomal Location50634633-50659780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50659370 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 33 (C33S)
Ref Sequence ENSEMBL: ENSMUSP00000034567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000034567] [ENSMUST00000117646]
Predicted Effect probably benign
Transcript: ENSMUST00000034566
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034567
AA Change: C33S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034567
Gene: ENSMUSG00000000168
AA Change: C33S

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 91 164 4.3e-17 PFAM
low complexity region 183 210 N/A INTRINSIC
Pfam:Biotin_lipoyl 218 292 1.2e-17 PFAM
low complexity region 315 344 N/A INTRINSIC
Pfam:E3_binding 350 385 2.6e-18 PFAM
Pfam:2-oxoacid_dh 412 642 9.9e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117646
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141919
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Dlat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Dlat APN 9 50645032 splice site probably benign
IGL00870:Dlat APN 9 50650869 missense probably damaging 1.00
R0440:Dlat UTSW 9 50645119 splice site probably null
R0530:Dlat UTSW 9 50637569 missense probably damaging 1.00
R0745:Dlat UTSW 9 50653708 missense probably damaging 0.99
R1870:Dlat UTSW 9 50637574 missense probably damaging 0.99
R3237:Dlat UTSW 9 50638031 missense possibly damaging 0.81
R3696:Dlat UTSW 9 50650876 missense possibly damaging 0.63
R3715:Dlat UTSW 9 50638054 missense probably damaging 1.00
R3924:Dlat UTSW 9 50658190 missense possibly damaging 0.55
R4016:Dlat UTSW 9 50649631 critical splice donor site probably null
R4197:Dlat UTSW 9 50636526 missense probably damaging 1.00
R4713:Dlat UTSW 9 50644481 missense probably benign
R5893:Dlat UTSW 9 50644139 splice site probably benign
R6138:Dlat UTSW 9 50645117 splice site probably null
R6778:Dlat UTSW 9 50650857 missense probably damaging 1.00
R7010:Dlat UTSW 9 50657974 missense probably damaging 1.00
U15987:Dlat UTSW 9 50645117 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACTCACCTTCTGATGCGG -3'
(R):5'- AGCCGCTTTTACGACACTGC -3'

Sequencing Primer
(F):5'- ACCTTCTGATGCGGAGGGAG -3'
(R):5'- TTTACGACACTGCGCGAC -3'
Posted On2015-12-29