Incidental Mutation 'R4789:Fdxacb1'
ID367326
Institutional Source Beutler Lab
Gene Symbol Fdxacb1
Ensembl Gene ENSMUSG00000037845
Gene Nameferredoxin-fold anticodon binding domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location50768236-50773348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50770118 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000037082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000042576] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177384] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000034561
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042391
AA Change: D113G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845
AA Change: D113G

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042576
SMART Domains Protein: ENSMUSP00000046890
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 15 164 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176160
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177142
Predicted Effect probably benign
Transcript: ENSMUST00000177384
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a ferredoxin-fold anticodon-binding domain which is contained in a subset of phenylalanyl tRNA synthetases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Fdxacb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Fdxacb1 APN 9 50771563 missense possibly damaging 0.75
IGL02828:Fdxacb1 APN 9 50771564 missense possibly damaging 0.75
IGL02799:Fdxacb1 UTSW 9 50772596 missense probably benign 0.01
R0755:Fdxacb1 UTSW 9 50771725 missense possibly damaging 0.87
R1283:Fdxacb1 UTSW 9 50768694 missense possibly damaging 0.79
R1395:Fdxacb1 UTSW 9 50772496 frame shift probably null
R1991:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2103:Fdxacb1 UTSW 9 50771646 missense probably benign 0.00
R2273:Fdxacb1 UTSW 9 50772021 missense probably benign 0.01
R2913:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R2914:Fdxacb1 UTSW 9 50768399 missense probably benign 0.05
R4289:Fdxacb1 UTSW 9 50772579 missense probably damaging 0.99
R4492:Fdxacb1 UTSW 9 50770247 missense probably damaging 0.99
R4668:Fdxacb1 UTSW 9 50770260 missense possibly damaging 0.74
R4742:Fdxacb1 UTSW 9 50768668 unclassified probably benign
R4935:Fdxacb1 UTSW 9 50771943 missense probably benign 0.00
R5190:Fdxacb1 UTSW 9 50772087 missense possibly damaging 0.78
R5652:Fdxacb1 UTSW 9 50768405 missense probably damaging 1.00
R6130:Fdxacb1 UTSW 9 50772602 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGCAAATGCCAAGCTGG -3'
(R):5'- ACAGCCTCACAGCTAAAGGG -3'

Sequencing Primer
(F):5'- ATGCCAAGCTGGTGACTAGTG -3'
(R):5'- AGGGACACACATCACTTAAAATG -3'
Posted On2015-12-29