Incidental Mutation 'R0412:Nckap1l'
ID36735
Institutional Source Beutler Lab
Gene Symbol Nckap1l
Ensembl Gene ENSMUSG00000022488
Gene NameNCK associated protein 1 like
SynonymsHem1, 4930568P13Rik
MMRRC Submission 038614-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R0412 (G1)
Quality Score224
Status Validated
Chromosome15
Chromosomal Location103453794-103498810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103464652 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 311 (S311C)
Ref Sequence ENSEMBL: ENSMUSP00000035400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047405] [ENSMUST00000229127]
Predicted Effect probably benign
Transcript: ENSMUST00000047405
AA Change: S311C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035400
Gene: ENSMUSG00000022488
AA Change: S311C

DomainStartEndE-ValueType
Pfam:Nckap1 7 1123 N/A PFAM
Predicted Effect silent
Transcript: ENSMUST00000229127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229468
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.2%
Validation Efficiency 94% (67/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HEM family of tissue-specific transmembrane proteins which are highly conserved from invertebrates through mammals. This gene is only expressed in hematopoietic cells. The encoded protein is a part of the Scar/WAVE complex which plays an important role in regulating cell shape in both metazoans and plants. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit anemia, lymphopenia, neutrophilia and tissue-specific pathology, defective neutrophil migration, phagocytosis and F-actin polymerization, abnormal B and T cell development, impaired T cell activation and adhesion, and enhanced IL-17 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik C G 7: 29,530,570 noncoding transcript Het
Arap1 C A 7: 101,390,222 A563D probably damaging Het
Arhgap28 G A 17: 67,896,258 L67F probably damaging Het
Atp7b G T 8: 21,995,659 probably null Het
Auts2 A G 5: 131,446,831 F485L probably benign Het
Ccdc68 A G 18: 69,960,439 E239G probably damaging Het
Cdc42bpg T G 19: 6,313,457 L449R probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Ddx41 G T 13: 55,530,608 S630Y probably damaging Het
Dntt T C 19: 41,042,933 L274P probably damaging Het
Fhl4 G T 10: 85,098,816 H34N possibly damaging Het
Filip1 A T 9: 79,820,289 N349K possibly damaging Het
Gm9894 C T 13: 67,765,026 noncoding transcript Het
Gpr179 A G 11: 97,338,807 S841P probably damaging Het
Gpr35 G T 1: 92,982,784 V73L probably benign Het
Grik5 A G 7: 25,013,674 V809A possibly damaging Het
H2-Bl T A 17: 36,081,521 probably benign Het
Heatr5b T C 17: 78,820,854 T451A probably benign Het
Hmcn2 G A 2: 31,388,247 V1654M probably damaging Het
Htra3 G T 5: 35,671,065 A157E probably damaging Het
Igf2r A T 17: 12,683,948 V2405D probably damaging Het
Irs3 C A 5: 137,643,877 R433L probably benign Het
Kcmf1 G A 6: 72,848,241 Q239* probably null Het
Kcnk9 A G 15: 72,513,056 probably benign Het
Kif28 A G 1: 179,702,526 V622A probably benign Het
Klrb1f A T 6: 129,054,331 I164F probably benign Het
Lama2 A G 10: 27,190,625 S1087P possibly damaging Het
Mchr1 A T 15: 81,235,747 probably benign Het
Mcidas A G 13: 112,999,143 T367A probably damaging Het
Mphosph8 A C 14: 56,674,413 K298Q probably damaging Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mst1 A C 9: 108,083,594 D461A probably benign Het
Olfr1036 C T 2: 86,075,091 A117V probably benign Het
Olfr1233 T A 2: 89,340,078 M75L probably benign Het
Olfr1385 T A 11: 49,494,767 V78E probably damaging Het
Olfr251 A C 9: 38,378,794 K298N probably damaging Het
Pde3a T G 6: 141,498,684 C1073G probably damaging Het
Pkhd1 T C 1: 20,117,788 D3432G probably damaging Het
Ppargc1b G T 18: 61,315,861 P130Q probably damaging Het
Ppp6r1 A G 7: 4,642,214 I228T probably damaging Het
Pram1 A G 17: 33,641,506 N349S probably benign Het
Ranbp6 C T 19: 29,812,083 V290I possibly damaging Het
Rcan3 A T 4: 135,416,603 probably null Het
Scn8a G C 15: 101,008,306 probably benign Het
Slc12a5 C T 2: 164,994,062 T900M probably benign Het
Srsf10 A G 4: 135,858,403 Y55C probably damaging Het
Syt7 G T 19: 10,444,080 E450* probably null Het
Tbrg4 T C 11: 6,623,832 K130R probably benign Het
Tgm7 C A 2: 121,101,065 V206F probably damaging Het
Tmem131l T C 3: 84,031,648 D67G probably damaging Het
Ttc7 A G 17: 87,330,044 K409R probably benign Het
Unc80 A T 1: 66,550,937 probably benign Het
Vmn1r171 C T 7: 23,632,655 L102F possibly damaging Het
Vmn2r59 A C 7: 42,046,492 probably benign Het
Vsig2 A G 9: 37,542,690 R191G probably damaging Het
Wdr86 T A 5: 24,718,234 Q153H probably benign Het
Xxylt1 T A 16: 31,007,798 N233I probably damaging Het
Zfp160 A T 17: 21,026,877 E563V probably damaging Het
Zfp345 T A 2: 150,473,403 E71D probably benign Het
Zfp541 A G 7: 16,082,174 D862G possibly damaging Het
Zfp639 A C 3: 32,517,110 Q47P possibly damaging Het
Other mutations in Nckap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Nckap1l APN 15 103462720 missense probably benign 0.42
IGL01818:Nckap1l APN 15 103478282 missense probably damaging 1.00
IGL01912:Nckap1l APN 15 103474146 missense probably benign 0.15
IGL01945:Nckap1l APN 15 103461642 missense probably damaging 1.00
IGL01947:Nckap1l APN 15 103491015 missense probably benign 0.32
IGL02218:Nckap1l APN 15 103483527 missense possibly damaging 0.47
IGL02317:Nckap1l APN 15 103461578 missense probably benign 0.05
IGL02376:Nckap1l APN 15 103471231 missense possibly damaging 0.95
IGL03263:Nckap1l APN 15 103464405 missense probably damaging 1.00
hem-haw UTSW 15 103471232 nonsense probably null
IGL02802:Nckap1l UTSW 15 103464536 missense probably benign 0.03
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0016:Nckap1l UTSW 15 103475636 missense probably benign
R0114:Nckap1l UTSW 15 103455028 missense probably benign
R0137:Nckap1l UTSW 15 103481964 missense probably benign 0.01
R0375:Nckap1l UTSW 15 103474159 missense probably damaging 0.98
R0390:Nckap1l UTSW 15 103453883 missense probably damaging 1.00
R0467:Nckap1l UTSW 15 103497427 missense probably benign 0.02
R1245:Nckap1l UTSW 15 103455925 missense probably damaging 1.00
R1592:Nckap1l UTSW 15 103482180 critical splice donor site probably null
R1593:Nckap1l UTSW 15 103478854 missense probably null 0.00
R1879:Nckap1l UTSW 15 103464601 missense probably benign
R2081:Nckap1l UTSW 15 103497454 missense probably damaging 0.98
R2144:Nckap1l UTSW 15 103475676 missense probably damaging 0.96
R2228:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2229:Nckap1l UTSW 15 103455934 critical splice donor site probably null
R2411:Nckap1l UTSW 15 103483568 missense probably damaging 1.00
R3965:Nckap1l UTSW 15 103464589 nonsense probably null
R3971:Nckap1l UTSW 15 103462560 missense probably damaging 1.00
R4270:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R4348:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4351:Nckap1l UTSW 15 103486819 missense probably damaging 0.99
R4748:Nckap1l UTSW 15 103473056 missense probably damaging 1.00
R4918:Nckap1l UTSW 15 103483613 missense probably benign
R5230:Nckap1l UTSW 15 103483639 missense probably benign 0.30
R5595:Nckap1l UTSW 15 103475658 missense possibly damaging 0.57
R5642:Nckap1l UTSW 15 103455025 missense probably benign 0.00
R5701:Nckap1l UTSW 15 103472768 missense probably benign 0.34
R6000:Nckap1l UTSW 15 103478815 missense probably benign 0.07
R6229:Nckap1l UTSW 15 103473122 missense possibly damaging 0.96
R6367:Nckap1l UTSW 15 103475722 missense probably benign 0.00
R6420:Nckap1l UTSW 15 103491466 missense possibly damaging 0.89
R6440:Nckap1l UTSW 15 103471232 nonsense probably null
R6957:Nckap1l UTSW 15 103491511 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGATGGCCTGTGAGTATCTGTCCG -3'
(R):5'- CTCTCTCGAAAACCCAGTGAGGCAC -3'

Sequencing Primer
(F):5'- TCATAAGTAAGTTGTAGGAGCACC -3'
(R):5'- TGAGGCACCAACCAAGAGTAG -3'
Posted On2013-05-09