Incidental Mutation 'R4789:Triobp'
ID367353
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78991028 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 137 (D137G)
Ref Sequence ENSEMBL: ENSMUSP00000155650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
Predicted Effect probably damaging
Transcript: ENSMUST00000109687
AA Change: D106G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: D106G

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: D1447G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: D1447G

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: D1493G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: D1493G

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130663
AA Change: D101G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088
AA Change: D101G

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
AA Change: D47G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088
AA Change: D47G

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229270
AA Change: D137G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Thbs2 C T 17: 14,671,488 G929D probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCTGACGGATTCAAGC -3'
(R):5'- AAAGTGCCTCACTCCAGGACTC -3'

Sequencing Primer
(F):5'- GACGGATTCAAGCCTCAAATATTAC -3'
(R):5'- CTCCAGGACTCTCTAGGTATGTTAAG -3'
Posted On2015-12-29