Incidental Mutation 'R4789:Thbs2'
ID367359
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R4789 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14671488 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 929 (G929D)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably damaging
Transcript: ENSMUST00000170872
AA Change: G929D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: G929D

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232616
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik C A 7: 116,093,522 D20E probably benign Het
1700057G04Rik G A 9: 92,351,031 C69Y probably damaging Het
Abcb9 T A 5: 124,078,790 M455L probably benign Het
Add2 G A 6: 86,118,770 V475M probably benign Het
Apoh T A 11: 108,409,238 Y238N probably damaging Het
Arpp21 A G 9: 112,067,292 S681P probably benign Het
Atp1a3 A C 7: 24,998,964 F149C probably damaging Het
B9d1 A G 11: 61,506,360 D27G probably benign Het
Bfar T A 16: 13,685,137 M1K probably null Het
Bok T C 1: 93,689,241 V103A probably damaging Het
Brca1 A C 11: 101,523,932 H1125Q probably benign Het
Card9 T A 2: 26,357,620 M218L probably damaging Het
Cers1 T C 8: 70,323,368 V303A probably damaging Het
Col6a5 T C 9: 105,937,335 I493V unknown Het
Coro7 T C 16: 4,628,221 Y880C probably damaging Het
Cyp2b19 T C 7: 26,764,376 Y318H probably benign Het
Dennd3 T A 15: 73,522,282 L52Q probably damaging Het
Dlat A T 9: 50,659,370 C33S probably benign Het
Dmxl2 T A 9: 54,379,815 Q2646L probably benign Het
Dnah3 T C 7: 120,011,072 N1703D probably damaging Het
Dock10 T A 1: 80,541,281 H1241L probably damaging Het
Fbxl17 T G 17: 63,487,915 I391L probably benign Het
Fdxacb1 A G 9: 50,770,118 D113G possibly damaging Het
Flii A G 11: 60,715,093 S1185P probably benign Het
Gm14496 A T 2: 181,995,784 Q217L possibly damaging Het
Heatr9 A T 11: 83,519,192 D74E probably benign Het
Heca C A 10: 17,908,147 E91* probably null Het
Ikzf4 T G 10: 128,632,706 T635P probably benign Het
Kif17 C T 4: 138,281,377 P382S probably damaging Het
Kmt5b T C 19: 3,815,330 V775A probably benign Het
Mapk8ip2 T A 15: 89,459,038 F661Y probably damaging Het
Mapkap1 A G 2: 34,533,847 E111G possibly damaging Het
Med9 T A 11: 59,948,440 N58K probably benign Het
Mid2 T A X: 140,678,232 Y61N probably damaging Het
Mief1 T A 15: 80,247,879 Y50* probably null Het
Mios T C 6: 8,235,429 M859T probably benign Het
Muc5ac G T 7: 141,798,882 C702F possibly damaging Het
Nkiras1 T C 14: 18,276,935 probably benign Het
Olfr266 A C 3: 106,822,292 I89R possibly damaging Het
Olfr266 T A 3: 106,822,308 M84L possibly damaging Het
Olfr291 T A 7: 84,857,301 C311S probably benign Het
Olfr681 T G 7: 105,122,313 H285Q probably null Het
Pcsk5 C T 19: 17,433,599 V1810M probably benign Het
Pex1 T C 5: 3,630,270 V964A probably damaging Het
Pgm2l1 A T 7: 100,267,587 M471L probably benign Het
Pkd1l2 T C 8: 117,011,575 T2182A probably damaging Het
Polr1b T A 2: 129,109,337 I290K probably benign Het
Prkg1 T A 19: 31,585,645 M119L probably damaging Het
Rbl1 A G 2: 157,177,355 V490A probably benign Het
Shtn1 G C 19: 59,050,873 R45G probably damaging Het
Slc10a6 T A 5: 103,628,982 Y84F probably benign Het
Slc25a23 T C 17: 57,059,597 D26G probably damaging Het
Slc41a2 T C 10: 83,316,456 K52E probably damaging Het
Slc4a5 T C 6: 83,270,969 F501L probably benign Het
Slfn5 T A 11: 82,956,400 M37K probably benign Het
Sptbn1 A C 11: 30,117,759 F1818L probably benign Het
Taf3 T C 2: 9,951,959 T466A probably damaging Het
Tmc3 A T 7: 83,622,538 D995V probably damaging Het
Tmem262 T C 19: 6,080,422 F59L possibly damaging Het
Triobp A G 15: 78,991,028 D137G probably damaging Het
Tspear T C 10: 77,866,365 F211L possibly damaging Het
Ttn A T 2: 76,898,326 probably benign Het
Ugt2b5 T A 5: 87,139,691 M206L probably benign Het
Ush1g A T 11: 115,318,640 S243T probably damaging Het
Usp19 A T 9: 108,493,234 T86S possibly damaging Het
Wdhd1 A G 14: 47,268,692 V255A probably benign Het
Wdr11 G A 7: 129,618,670 W594* probably null Het
Wnk3 T A X: 151,210,937 Y331* probably null Het
Zfp429 A T 13: 67,390,404 I307K probably benign Het
Zkscan14 T A 5: 145,195,634 K362N probably damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCCAGGGTCTGAGTTTGC -3'
(R):5'- TCCCTGGGATGCCTTATAGC -3'

Sequencing Primer
(F):5'- GCTGTCTGCACCAGCTC -3'
(R):5'- CCTGGGATGCCTTATAGCTTTACAAG -3'
Posted On2015-12-29