Incidental Mutation 'R4770:C2cd3'
ID367407
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 042410-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4770 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100443435 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 495 (Y495C)
Ref Sequence ENSEMBL: ENSMUSP00000113728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: Y1726C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: Y1726C

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: Y1726C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: Y1726C

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119647
AA Change: Y1348C
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: Y1348C

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: Y495C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: Y495C

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184779
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 93% (89/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 110,071,515 V503A possibly damaging Het
Agps T A 2: 75,891,855 F463Y possibly damaging Het
Amigo3 A T 9: 108,053,535 L52F probably damaging Het
Anapc1 T C 2: 128,686,060 probably benign Het
Ankrd36 G T 11: 5,590,870 C312F possibly damaging Het
Asic2 A C 11: 80,971,492 D226E probably benign Het
Atp8b2 T A 3: 89,957,067 Q197L probably damaging Het
Ccdc51 A G 9: 109,090,910 T125A probably benign Het
Ccser1 A G 6: 61,311,501 Y216C possibly damaging Het
Cntfr A T 4: 41,663,282 I175N possibly damaging Het
Cox10 G A 11: 63,964,163 R431W probably benign Het
Cubn T C 2: 13,314,767 T2881A possibly damaging Het
Cyp2d9 T A 15: 82,452,573 V41E probably damaging Het
Dmrtb1 C T 4: 107,683,789 G125D probably benign Het
Dscaml1 C T 9: 45,670,106 R408C probably damaging Het
Duox2 A T 2: 122,284,916 S1052T probably benign Het
Ecm1 A G 3: 95,737,961 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Epb41l1 T A 2: 156,529,424 M727K probably benign Het
Exosc9 T C 3: 36,553,835 V64A probably damaging Het
Ezh2 A T 6: 47,540,696 I564N probably damaging Het
Fam160b2 T A 14: 70,588,287 D351V probably damaging Het
Fam89b C A 19: 5,729,454 R25L probably damaging Het
Fgr C T 4: 132,987,291 T98M probably damaging Het
Gapvd1 A G 2: 34,691,181 S1089P probably damaging Het
Gbp5 A T 3: 142,508,076 I544F possibly damaging Het
Gli2 C A 1: 118,982,588 probably benign Het
Gm13084 C T 4: 143,811,949 E151K probably damaging Het
Gm9934 A G 7: 93,052,984 noncoding transcript Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Greb1 A T 12: 16,681,356 D1660E probably benign Het
Gtf2i T A 5: 134,243,560 N750I possibly damaging Het
H2-DMb2 G C 17: 34,148,724 D171H probably damaging Het
Il11ra1 A G 4: 41,768,187 E366G probably damaging Het
Itga2b A G 11: 102,460,756 F581S probably damaging Het
Itsn2 T A 12: 4,627,892 M83K probably damaging Het
Kif27 G A 13: 58,344,377 T316M probably damaging Het
Lad1 A T 1: 135,825,793 Q26L probably damaging Het
Lrrn3 T A 12: 41,452,443 H625L probably benign Het
Mast1 A G 8: 84,929,246 V155A probably benign Het
Mast3 G A 8: 70,786,220 T480M probably damaging Het
Mpc1 C T 17: 8,293,545 probably benign Het
Mycbp2 T A 14: 103,219,944 M1606L probably benign Het
Myo1c T A 11: 75,660,313 L238* probably null Het
Nanog T G 6: 122,711,591 S44A possibly damaging Het
Neb T C 2: 52,149,153 Q6958R probably benign Het
Ngef C T 1: 87,477,561 R709H probably damaging Het
Nr1d1 A G 11: 98,770,645 V265A probably benign Het
Nr3c2 A G 8: 76,908,243 probably null Het
Odf3b A G 15: 89,379,123 I19T probably damaging Het
Olfm5 A G 7: 104,160,478 S164P probably benign Het
Parvb T C 15: 84,303,905 probably null Het
Pde4dip G T 3: 97,767,084 A172D probably damaging Het
Phf2 A G 13: 48,803,603 L1096P probably damaging Het
Pik3r6 T A 11: 68,529,894 V155E probably damaging Het
Pinx1 T G 14: 63,872,371 V124G probably damaging Het
Poglut1 A G 16: 38,534,757 Y236H probably damaging Het
Pou4f2 T A 8: 78,436,401 M2L unknown Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkaca A G 8: 83,990,870 N209S probably benign Het
Ring1 G A 17: 34,023,387 P49S probably damaging Het
Rnf20 T A 4: 49,633,412 probably null Het
Rnf25 G A 1: 74,593,940 R418C probably damaging Het
Ryr1 G T 7: 29,109,282 P462Q probably damaging Het
Serpinb3d A G 1: 107,078,278 F360S probably damaging Het
Setd7 T C 3: 51,521,422 E329G probably damaging Het
Slco2b1 C T 7: 99,670,949 probably null Het
Snap91 G A 9: 86,773,601 T844I possibly damaging Het
Snhg5 C T 9: 88,522,371 noncoding transcript Het
Son T A 16: 91,658,868 V1501E probably damaging Het
Syncrip T A 9: 88,479,852 E70V probably damaging Het
Tas2r125 A G 6: 132,909,787 D46G probably damaging Het
Tmem115 G A 9: 107,534,957 R160Q probably benign Het
Trerf1 G A 17: 47,319,655 noncoding transcript Het
Uggt2 A T 14: 119,029,054 probably null Het
Ush2a G T 1: 188,549,879 V1864F probably benign Het
Xkr4 A T 1: 3,216,491 V492D probably damaging Het
Zcchc6 A G 13: 59,772,884 probably benign Het
Zfp646 T A 7: 127,883,477 S1609T possibly damaging Het
Zfp65 A T 13: 67,708,358 H277Q probably damaging Het
Zfp69 A G 4: 120,934,417 S176P probably damaging Het
Zfp747 C T 7: 127,375,799 A10T probably damaging Het
Zfp850 T C 7: 27,984,986 probably null Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AAAATGACTTTGTAACAGGCTCTGG -3'
(R):5'- CCTTATAGGAGAACCTTTAGCTAGG -3'

Sequencing Primer
(F):5'- CCAGTCTTGTCAGTGGCTCTAG -3'
(R):5'- ACCTTTAGCTAGGAGTGATCAAG -3'
Posted On2015-12-29