Incidental Mutation 'R4771:Reln'
ID367482
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4771 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22049700 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 557 (D557G)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: D557G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: D557G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159741
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: D557G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: D557G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162427
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,558,973 L190P probably damaging Het
2310022B05Rik T C 8: 124,639,561 T148A probably benign Het
Abcc4 G T 14: 118,484,384 N1234K probably benign Het
Adamts20 C T 15: 94,351,635 probably null Het
Aqp9 C T 9: 71,122,870 G212S probably damaging Het
Asb15 A T 6: 24,570,622 N533I probably damaging Het
Brwd1 A G 16: 96,003,318 V1884A probably benign Het
Casc4 T A 2: 121,925,645 V352E probably damaging Het
Ccdc106 G A 7: 5,057,522 probably null Het
Cfap46 A T 7: 139,630,608 L1774Q probably null Het
Clec2h G A 6: 128,674,155 E133K probably damaging Het
Cntn1 T A 15: 92,305,091 F751L possibly damaging Het
Col20a1 A T 2: 180,989,124 M62L probably benign Het
Col7a1 T C 9: 108,971,925 V1899A probably damaging Het
Cpa5 T A 6: 30,612,685 L28* probably null Het
Crb1 T A 1: 139,328,204 E264D probably damaging Het
Creb3l2 A T 6: 37,334,577 S426T probably benign Het
Cspg5 T A 9: 110,251,127 N373K probably damaging Het
Ctso T C 3: 81,932,740 S26P probably benign Het
Depdc1b A C 13: 108,382,900 D348A probably benign Het
Diaph1 A T 18: 37,853,551 M1127K probably damaging Het
Dlgap1 A T 17: 70,593,380 K397* probably null Het
Dock3 T A 9: 106,952,358 H1119L possibly damaging Het
Dok4 G T 8: 94,865,167 probably null Het
Dram2 A G 3: 106,573,045 T225A probably damaging Het
Dst G A 1: 34,249,484 R5603H probably damaging Het
Ehbp1l1 A G 19: 5,725,968 F18S probably damaging Het
Epha5 A G 5: 84,150,419 V427A probably damaging Het
Exoc4 A T 6: 33,441,949 probably null Het
Exph5 C T 9: 53,373,665 T682I possibly damaging Het
Fam35a G A 14: 34,268,706 T81M probably damaging Het
Fam92a T A 4: 12,155,689 Q311L probably benign Het
Fnbp1l A T 3: 122,558,103 S264T possibly damaging Het
Ggnbp2 A T 11: 84,834,488 D580E probably benign Het
Gm10277 G A 11: 77,785,708 probably benign Het
Gtf2a1l C A 17: 88,690,020 P93Q probably benign Het
Hydin A T 8: 110,532,883 I2496F probably benign Het
Ighv7-2 A C 12: 113,912,467 I6S probably benign Het
Irs1 A G 1: 82,287,975 V840A probably benign Het
Itgal A G 7: 127,328,233 E965G probably damaging Het
Izumo1 T G 7: 45,622,809 F5V probably benign Het
Izumo1 T A 7: 45,622,810 F5Y probably damaging Het
Kif13a A G 13: 46,825,211 S175P probably damaging Het
Klf14 A G 6: 30,958,025 F225L probably damaging Het
Kpna1 T C 16: 36,033,403 Y468H probably damaging Het
Krt5 T A 15: 101,709,059 Q413L probably damaging Het
Lbr T C 1: 181,838,421 Y41C probably damaging Het
Lmcd1 A T 6: 112,315,873 N229Y probably damaging Het
March3 T A 18: 56,783,098 H175L probably benign Het
Mcmbp A G 7: 128,698,400 probably null Het
Med27 T A 2: 29,413,503 L16Q probably damaging Het
Mex3b A T 7: 82,869,065 Q196L possibly damaging Het
Mga T C 2: 119,964,294 S2820P probably damaging Het
Mroh2a C T 1: 88,251,365 L1104F probably damaging Het
Mta3 A G 17: 83,755,674 E166G probably damaging Het
Mthfd2l A G 5: 90,948,868 E116G possibly damaging Het
Musk A G 4: 58,301,706 I155V probably benign Het
Myh7b G A 2: 155,626,394 W834* probably null Het
Myo18b T A 5: 112,692,227 R2567* probably null Het
Nars2 A T 7: 97,035,245 E325V probably damaging Het
Nploc4 A G 11: 120,421,434 V106A possibly damaging Het
Nudcd1 A T 15: 44,405,482 S167R probably damaging Het
Nup133 T A 8: 123,929,398 D448V probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr495 A T 7: 108,396,022 K301* probably null Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdh8 C T 14: 79,768,270 A893T possibly damaging Het
Per3 A T 4: 151,009,259 V1033E probably damaging Het
Polr1e T C 4: 45,019,282 S44P probably damaging Het
Pou4f2 T A 8: 78,435,236 H246L possibly damaging Het
Psmd2 G A 16: 20,662,679 R828Q probably damaging Het
Ptprq A G 10: 107,688,427 S482P probably benign Het
Rbm14 G T 19: 4,802,643 probably benign Het
Rhobtb2 A G 14: 69,797,050 I242T probably benign Het
Runx1 C A 16: 92,695,741 V5L possibly damaging Het
Slc13a1 A T 6: 24,100,340 Y381* probably null Het
Smyd3 A T 1: 179,094,396 C180S probably damaging Het
Sntg2 T A 12: 30,276,659 probably null Het
Snx19 G A 9: 30,433,638 V678I probably damaging Het
Spag5 G A 11: 78,304,766 A300T probably damaging Het
Spdl1 T A 11: 34,813,327 R560W probably damaging Het
Spen T C 4: 141,472,596 T2884A probably benign Het
Spg11 G A 2: 122,065,482 Q1752* probably null Het
Srrm4 C A 5: 116,475,175 probably null Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Sspo A G 6: 48,460,879 D1324G probably damaging Het
Tkt T G 14: 30,567,025 I238S probably damaging Het
Tmem184b A T 15: 79,377,177 N76K probably benign Het
Trpm6 A G 19: 18,813,493 M631V probably damaging Het
Ttll6 A C 11: 96,133,829 E15A possibly damaging Het
Ttn T C 2: 76,738,952 D27199G probably damaging Het
Ubn2 A T 6: 38,487,153 probably null Het
Ubr5 A C 15: 38,018,297 I866M possibly damaging Het
Urb1 T C 16: 90,753,518 T2149A probably benign Het
Ush2a G T 1: 188,797,769 V3252L possibly damaging Het
Usp24 A G 4: 106,362,180 probably null Het
Vill T A 9: 119,068,434 M259K probably damaging Het
Vldlr T C 19: 27,239,890 I411T probably damaging Het
Vmn2r120 A T 17: 57,524,887 W301R probably damaging Het
Vps13b G A 15: 35,910,800 S3570N probably damaging Het
Vps13c T C 9: 67,929,539 V1773A probably benign Het
Vtn A G 11: 78,501,574 D326G probably benign Het
Wdr93 A T 7: 79,776,763 H592L probably damaging Het
Zdhhc19 A G 16: 32,499,135 D94G probably damaging Het
Zfand4 A T 6: 116,314,350 E188V probably damaging Het
Zfp523 C A 17: 28,201,338 probably null Het
Zfp536 T C 7: 37,568,884 D369G probably damaging Het
Zfp608 T A 18: 54,988,300 T72S probably benign Het
Zfp804a T A 2: 82,257,942 V705E probably benign Het
Zfp974 T C 7: 27,926,308 T46A probably damaging Het
Zkscan4 C T 13: 21,479,246 Q52* probably null Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGACAAACTTACTTCAATGGTCC -3'
(R):5'- CCTGGTGTGCAGTAAATGGC -3'

Sequencing Primer
(F):5'- ACTTCAATGGTCCAGTGCATG -3'
(R):5'- GCAGTAAATGGCAGTTCTGTATTTAG -3'
Posted On2015-12-29