Incidental Mutation 'R4771:Adamts20'
ID367547
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Stock #R4771 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to T at 94351635 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000129195] [ENSMUST00000155907]
Predicted Effect probably null
Transcript: ENSMUST00000035342
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129195
Predicted Effect probably null
Transcript: ENSMUST00000155907
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
SMART Domains
(Predicted Sequence)

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 9.4e-31 PFAM
Pfam:Reprolysin_5 253 445 2.4e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 9.7e-27 PFAM
Pfam:Reprolysin_2 272 454 1.2e-10 PFAM
Pfam:Reprolysin_3 276 410 4e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 1.8e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028P14Rik A G 19: 23,558,973 L190P probably damaging Het
1700049G17Rik T C 7: 27,926,308 T46A probably damaging Het
2310022B05Rik T C 8: 124,639,561 T148A probably benign Het
Abcc4 G T 14: 118,484,384 N1234K probably benign Het
Abcc5 T C 16: 20,332,587 K1199R noncoding transcript Het
Abcg5 C T 17: 84,670,323 G213R silent Het
Aqp9 C T 9: 71,122,870 G238S probably damaging Het
Asb15 A T 6: 24,570,622 N533I probably damaging Het
Brwd1 A G 16: 96,003,318 V1884A probably benign Het
Casc4 T A 2: 121,925,645 V385E probably damaging Het
Ccdc106 G A 7: 5,057,522 G27E probably damaging Het
Cfap46 A T 7: 139,630,608 L1774Q probably null Het
Clec2h G A 6: 128,674,155 E133K probably damaging Het
Cntn1 T A 15: 92,305,091 F751L possibly damaging Het
Col20a1 A T 2: 180,989,124 M62L probably benign Het
Col7a1 T C 9: 108,971,925 V1899A probably damaging Het
Cpa5 T A 6: 30,612,685 L28* probably null Het
Crb1 T A 1: 139,328,204 E264D probably damaging Het
Creb3l2 A T 6: 37,334,577 S426T probably benign Het
Cspg5 T A 9: 110,251,127 N373K probably damaging Het
Ctso T C 3: 81,932,740 S26P probably benign Het
Depdc1b A C 13: 108,382,900 D348A probably benign Het
Diap1 A T 18: 37,853,551 M1127K probably damaging Het
Dlgap1 A T 17: 70,593,380 K397* probably null Het
Dock3 T A 9: 106,952,358 H1119L possibly damaging Het
Dok4 G T 8: 94,865,167 Q314K probably benign Het
Dram2 A G 3: 106,573,045 T225A probably damaging Het
Dst G A 1: 34,249,484 R5603H probably damaging Het
Ehbp1l1 A G 19: 5,725,968 F18S probably damaging Het
Epha5 A G 5: 84,150,419 V427A probably damaging Het
Exoc4 A T 6: 33,441,949 probably null Het
Exph5 C T 9: 53,373,665 T682I possibly damaging Het
Fam35a G A 14: 34,268,706 T81M probably benign Het
Fam92a T A 4: 12,155,689 Q311L probably benign Het
Fnbp1l A T 3: 122,558,103 S264T possibly damaging Het
Ggnbp2 A T 11: 84,834,488 D620E probably benign Het
Gm10277 G A 11: 77,785,708 R146C unknown Het
Gm26669 C A 12: 80,112,801 R537S noncoding transcript Het
Gtf2a1l C A 17: 88,690,020 P93Q probably benign Het
Hydin A T 8: 110,532,883 I2496F probably benign Het
Ighv7-2 A C 12: 113,912,467 I6S probably benign Het
Irs1 A G 1: 82,287,975 V840A probably benign Het
Itgal A G 7: 127,328,233 E965G probably damaging Het
Izumo1 T G 7: 45,622,809 F5V probably benign Het
Izumo1 T A 7: 45,622,810 F5Y probably damaging Het
Kif13a A G 13: 46,825,211 S238P probably damaging Het
Kif6 A T 17: 49,758,489 *74L silent Het
Klf14 A G 6: 30,958,025 F225L probably damaging Het
Kpna1 T C 16: 36,033,403 Y468H probably damaging Het
Krt5 T A 15: 101,709,059 Q413L probably damaging Het
Lbr T C 1: 181,838,421 Y41C probably damaging Het
Lmcd1 A T 6: 112,315,873 N229Y probably damaging Het
Lnx1 C T 5: 74,660,547 V34I unknown Het
March3 T A 18: 56,783,098 H175L probably benign Het
Mcmbp A G 7: 128,698,400 C84R probably null Het
Med27 T A 2: 29,413,503 L16Q probably damaging Het
Mex3b A T 7: 82,869,065 Q196L possibly damaging Het
Mga T C 2: 119,964,294 S2820P probably damaging Het
Mroh2a C T 1: 88,251,365 L1104F probably damaging Het
Mta3 A G 17: 83,755,674 E166G probably damaging Het
Mthfd2l A G 5: 90,948,868 E116G possibly damaging Het
Musk A G 4: 58,301,706 I155V probably benign Het
Myh7b G A 2: 155,626,394 W834* probably null Het
Myo18b T A 5: 112,692,227 R2567* probably null Het
Nars2 A T 7: 97,035,245 E325V probably damaging Het
Nploc4 A G 11: 120,421,434 V106A possibly damaging Het
Nudcd1 A T 15: 44,405,482 S167R probably damaging Het
Nup133 T A 8: 123,929,398 D448V probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1273-ps G A 2: 90,296,642 T73M noncoding transcript Het
Olfr495 A T 7: 108,396,022 K301* probably null Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Pcdh8 C T 14: 79,768,270 A893T possibly damaging Het
Per3 A T 4: 151,009,259 V1033E probably damaging Het
Polr1e T C 4: 45,019,282 S44P probably damaging Het
Pou4f2 T A 8: 78,435,236 H246L possibly damaging Het
Psmd2 G A 16: 20,662,679 R828Q probably damaging Het
Ptprq A G 10: 107,688,427 S482P probably benign Het
Rbm14 G T 19: 4,802,643 N570K unknown Het
Reln T C 5: 22,049,700 D557G probably damaging Het
Rhobtb2 A G 14: 69,797,050 I242T probably benign Het
Runx1 C A 16: 92,695,741 V5L possibly damaging Het
Slc13a1 A T 6: 24,100,340 Y381* probably null Het
Smyd3 A T 1: 179,094,396 C180S probably damaging Het
Sntg2 T A 12: 30,276,659 probably null Het
Snx19 G A 9: 30,433,638 V678I probably damaging Het
Spag5 G A 11: 78,304,766 A300T probably damaging Het
Spdl1 T A 11: 34,813,327 R560W probably damaging Het
Spen T C 4: 141,472,596 T2884A probably benign Het
Spg11 G A 2: 122,065,482 Q1752* probably null Het
Srrm4 C A 5: 116,475,175 probably null Het
Ssc4d A G 5: 135,970,220 L43P probably damaging Het
Sspo A G 6: 48,460,879 D1324G probably damaging Het
Tkt T G 14: 30,567,025 I238S probably damaging Het
Tmem184b A T 15: 79,377,177 N76K probably benign Het
Trpm5 G T 7: 143,073,219 Q1172K silent Het
Trpm6 A G 19: 18,813,493 M631V probably damaging Het
Ttll6 A C 11: 96,133,829 E15A possibly damaging Het
Ttn T C 2: 76,738,952 D27199G probably damaging Het
Ubn2 A T 6: 38,487,153 K27* probably null Het
Ubr5 A C 15: 38,018,297 I866M probably benign Het
Urb1 T C 16: 90,753,518 T2149A probably benign Het
Ush2a G T 1: 188,797,769 V3252L possibly damaging Het
Usp24 A G 4: 106,362,180 probably null Het
Vill T A 9: 119,068,434 M643K probably damaging Het
Vldlr T C 19: 27,239,890 I411T probably damaging Het
Vmn2r120 A T 17: 57,524,887 W301R probably damaging Het
Vps13b G A 15: 35,910,800 S3570N probably damaging Het
Vps13c T C 9: 67,929,539 V1773A probably benign Het
Vtn A G 11: 78,501,574 D326G probably benign Het
Wdr93 A T 7: 79,776,763 H592L probably damaging Het
Zdhhc19 A G 16: 32,499,135 D190G probably damaging Het
Zfand4 A T 6: 116,314,350 E188V probably damaging Het
Zfp523 C A 17: 28,201,338 R277S probably null Het
Zfp536 T C 7: 37,568,884 D369G probably damaging Het
Zfp608 T A 18: 54,988,300 T72S probably benign Het
Zfp804a T A 2: 82,257,942 V705E probably benign Het
Zkscan4 C T 13: 21,479,246 Q52* probably null Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTGGCTATACCTTCCG -3'
(R):5'- GCCATGTGTACACGTGTATTC -3'

Sequencing Primer
(F):5'- CTGTGGCTATACCTTCCGAATAGG -3'
(R):5'- GTATTCACACTGTCCTGTTTTCTG -3'
Posted OnDec 29, 2015