Incidental Mutation 'R4772:Nr1i3'
ID367573
Institutional Source Beutler Lab
Gene Symbol Nr1i3
Ensembl Gene ENSMUSG00000005677
Gene Namenuclear receptor subfamily 1, group I, member 3
SynonymsCare2, CAR1, mCAR, CAR, ESTM32, MB67
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171213970-171220701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171217150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 218 (T218I)
Ref Sequence ENSEMBL: ENSMUSP00000106960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000075469] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000147246] [ENSMUST00000155126]
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000005820
AA Change: T218I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677
AA Change: T218I

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075469
AA Change: T218I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677
AA Change: T218I

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111328
AA Change: T218I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677
AA Change: T218I

DomainStartEndE-ValueType
ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect possibly damaging
Transcript: ENSMUST00000155126
AA Change: T81I

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677
AA Change: T81I

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to TCPOBOP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Nr1i3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Nr1i3 APN 1 171214972 missense possibly damaging 0.79
IGL02401:Nr1i3 APN 1 171216373 splice site probably benign
IGL02964:Nr1i3 APN 1 171214395 missense probably benign 0.00
election UTSW 1 171216382 missense probably damaging 0.99
R0023:Nr1i3 UTSW 1 171217331 missense probably damaging 0.99
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0504:Nr1i3 UTSW 1 171217236 splice site probably benign
R1437:Nr1i3 UTSW 1 171217141 frame shift probably null
R1754:Nr1i3 UTSW 1 171217394 missense probably damaging 1.00
R1893:Nr1i3 UTSW 1 171217223 critical splice donor site probably null
R2116:Nr1i3 UTSW 1 171218594 missense probably damaging 1.00
R3613:Nr1i3 UTSW 1 171214995 nonsense probably null
R3787:Nr1i3 UTSW 1 171214425 missense probably damaging 1.00
R4627:Nr1i3 UTSW 1 171216445 missense probably benign 0.00
R4792:Nr1i3 UTSW 1 171218595 missense probably damaging 0.99
R4880:Nr1i3 UTSW 1 171216382 missense probably damaging 0.99
R5072:Nr1i3 UTSW 1 171216813 missense probably benign 0.11
R5349:Nr1i3 UTSW 1 171215072 missense possibly damaging 0.94
R5527:Nr1i3 UTSW 1 171214352 missense possibly damaging 0.91
R6768:Nr1i3 UTSW 1 171217397 missense probably damaging 1.00
R6824:Nr1i3 UTSW 1 171214973 missense probably benign 0.00
X0027:Nr1i3 UTSW 1 171214377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCTGAGTGCTAGGGTCTTAC -3'
(R):5'- TGGAGATGCAGTCCTTTCAGG -3'

Sequencing Primer
(F):5'- CTTACATTTGCAGTGTGCCG -3'
(R):5'- AACTCGTACTGGAACCCTGCTG -3'
Posted On2015-12-29