Incidental Mutation 'R4772:Slc16a1'
ID367591
Institutional Source Beutler Lab
Gene Symbol Slc16a1
Ensembl Gene ENSMUSG00000032902
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 1
SynonymsMCT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location104638668-104658462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104653564 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 395 (V395A)
Ref Sequence ENSEMBL: ENSMUSP00000045216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046212
AA Change: V395A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045216
Gene: ENSMUSG00000032902
AA Change: V395A

DomainStartEndE-ValueType
Pfam:MFS_1 17 399 3e-33 PFAM
Pfam:MFS_1 325 480 1.6e-10 PFAM
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes are non-viable, while heterozygous animals are resistant to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Slc16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0432:Slc16a1 UTSW 3 104653419 missense probably benign 0.00
R0532:Slc16a1 UTSW 3 104653418 nonsense probably null
R1638:Slc16a1 UTSW 3 104649482 missense possibly damaging 0.96
R1826:Slc16a1 UTSW 3 104650939 missense probably benign 0.22
R1900:Slc16a1 UTSW 3 104653564 missense probably damaging 0.97
R1964:Slc16a1 UTSW 3 104649466 missense probably damaging 1.00
R3615:Slc16a1 UTSW 3 104653570 missense probably damaging 1.00
R3616:Slc16a1 UTSW 3 104653570 missense probably damaging 1.00
R4485:Slc16a1 UTSW 3 104655478 missense probably benign 0.13
R6106:Slc16a1 UTSW 3 104652994 missense probably benign
R6123:Slc16a1 UTSW 3 104653194 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTGTGCCATTTGCTTGCC -3'
(R):5'- CCAAGATGCACAGGGGTTAG -3'

Sequencing Primer
(F):5'- GCCCCTTTGTCTACAACCTACG -3'
(R):5'- TGGTACACTTGATGCCACG -3'
Posted On2015-12-29